Description :
Non Conding Region
Location :
Scaffold_1:142515- 143152
Sequence
637 bases(100 bases per row)
GCGTCCAGCAACCTCGGGCGAGCGTCAAAGAGGCTCGGCAGTGGCGGACATTTGGGGACTTTGACGTGATAGGGAAAGTCTGCCAAGTCGTTGTCGTCCC
ACACACTTTGGTCGCAGTCGCAGTAGAGCGAGTGGTTGACACCTTCGATCGTGGCAGGCACCAACTGACACCAGTTCTTGTAGCACTGCGTCCCCAAGTG
GATGTCCAGATTGCTGCATTCTTGTCTGATCAAGGCTGTCGCGACGCCATCTCGAGCTTCTGGCGAAACACTGCGAGGACAGACCAGGATCAACGACCGA
ATGTCTCGAAGACTCAAGAAAGACACCAGCCCATTATCCAGAAGCACCACCAGGTCTGCCAAGCTTGGGGCTGTCCTTTGCTTCTTGGTCTTGTTGGTCG
ACATGAATGTGGTATTTTCCAACATCGAAGGCATCATGGGATTGTACAGTACACTGACACAACTACCAATAATACACTTCCACTATCTCACGGTTTGGTT
TTGTGTAGACGGAGGCAACCTTGTTGCTCCCAAAGGTTTTGAGTTCCTTCAGACCCCCCCCCCCACTTGTCGAACGTGTCACCTTTTCGCCGCATCTTTG
GACGGTCTCAAAATCAGAAGAAGCTCGGGCGTCTCGA