Description :
Non Conding Region
Location :
Scaffold_1:142360- 142568
Sequence
208 bases(100 bases per row)
cggagaggagaagactgttccgcaccgtgactacgtgcgtgctctagactggttccaattggcagccgcgtcttcttctgatgacaagaaggtggagatg
gtgctcgcaacaggatcttgggacaagactgtgcacaagtggaacgtggatgactacactgcttctgagatgaacacaacgcccgctacaggcctggcag
ctccgccg