Description :
Non Conding Region
Location :
scaffold_1:142035- 142436
Sequence
401 bases(100 bases per row)
AAAGCTGGAGCCTCATTTGCAACAAATTTATTTCAACGTGAATCTGACCCCCCAGCCGAAGAATATTAACTGACACTGGCGTGACGGCGTAAAACTTCGG
CCACTTGGAGATGGCCATTACGCAGAGCCAAGTCTATTGCAGTGGAGTGGGATGCCTCCGGAAGTGGAAGTGTTGAGTCGACGCCGTCCTCACTGACCAG
CGCTTCACAACACTCAGCAAATCCTTCGTCAGCAGCGATCAGCAGGGCAGTGTATTCGAAGCGGTTGCGTTGATTAAAGAGCGATCGTGTCCAGTCTTGA
TCCAGGTTCGATGATTGACGAAGGTGTCGCAGTATGAGTTGCAGCGAGCTTAGTGCGTTGGCTGCTGCGAGATGGAGGATTGAGTTTCCATCGGGGTCCG
T