Description :
Non Conding Region
Location :
Scaffold_1:141771- 142969
Sequence
1198 bases(100 bases per row)
CCTGTATTGCTTGGCCTTGTGGACGACGCCAAAGTAGCAATATTGTCTATATGCGTATTTGGTATATTAATTGTTTTTATGTTTCCATTATTTTTTCTAT
TATATTGGGACCACAAACAAATGAGACCACGAACAAACTTCAACCGGAGAATAGTGCTTTCGCTCGAAGCTCTATCGGCGCCCGAGGTGATCGTAATGGC
CAGTGGCAACATAGCGCGATGTAGGCCAGGGGCTGTCCTCGCCCAGCTCAGCGACTCGCTCGCTGAGCTGGGCGTCGCTGACGCCACGCTACATGGGCCA
CCGCACTGAATCCGCACCCACGTCGCTGGTCAGGCGCTGCTGGGCAAAGGCAATCTGAACGGTCGCGTTTCCGCCGCTCTTGTCGTCGTGTAGATCTTGT
CTCGAAAAGAACAGTATCGCTGCATGGAGCTGTGCGCTTGGCGGTTGCACGCGATACCGACTGTGCGGGCACCTATTTGCGCCCGCCAACTCGACTCGAC
AAGTGTCGTGTGCAGCCCAGCGCTGGTAGATGAGTCAGCCGAGTACACATAAGAACGCATGCACTAAAGAATTGCTACTATATATGAGACTTGAACACCA
CGCTATTAAAAGGTCAAAATGGCATTACTCCAACATTTCCTCGCTGTAAATAAAGAAGAGCTGACGGACTGCGAGCAGCATGCGCACCGCCAACGCTTCA
GAACCAAAGCACCGCTCGAATGGGGCCCCAACGACCATCCCTTGCTGAGCCGACTCACCTTCAGCTTTGGTCTCGCCAGCCTTCAACCCCCTTCAGTTCC
TGGAAAAACTGGTCGGGACAGCCACTCGACTCCGCCACCACTCGATGACTCTTGACCTTCCTTCGTCGCAACGGACCACGCTCGCACGCATCCGCCAAGC
CAATTATACACCATATGAATAATGCAGAGCCTCCCCTGCTGCCGTCGGCCGAAGTCGCTCTCCATCGCAAAGAGACTGAAGCCGCTGCTCGACTTCGACC
GACCAAGTGGCAGCAAAGGATTCCAACGCCACTAGACCCGTCAGTTTCCCTTCCACCCTCAGTTCCTCCTTCCCACGCTCCCTTCCCCTCCTCGTTTCCT
TCTTTGTCCCGTGTCGTCGTCCCACCATCACCGTCGTCCTCTCCTCGTCTTTCACTTCGGCAAGGGCGGAGCGACTTCCACTCGATCAACCCGTCCTT