Description :
Non Conding Region
Location :
Scaffold_1:14141- 16282
Sequence
2141 bases(100 bases per row)
GTGGTCACTCAGAGGCTTCCACTGTGCACGCAAATGCCGGAATGCTCACCATCTTCCAGCCTGCGGGgTCATCCCCGACTCTTCCGTGCGGACGCCACAT
GGGTGGGTGAGCACCAGGCGCTTTCCCGACTTCGCGCAGTCTGCTTGGCATGTGTGGGCGTGAAAAAGCCAGCACAGAATGGCGCTGAGCGTCGATGCCG
GctGTGATCATGGGCACCTGCCAGATGGCGCCACGGCGCACAGCAGCAACGGGGACTGATGAAGTCCACAAGGCTGCACCACGGTGGACGAGTCGCGACT
GGCAGGAACCAGATGGCGGATTGCGCCCAGAGGCGCCGGCTCGATCTTTTACATGGCGGGCTGTCCGACCACAAGCAGGCCGCGCGCAGTTGGGATCTCC
GAACGCAGCCATCGTCCAGCACGACGAGCACGGGCTGCATGGAGCAGGATGGCACACGCACGACGAGACGAGCTGATAGAACCGACGCGAAACCGGTTCT
TCCTGCGCCGCCGCATCCGACTCATCGACATGCTGAGTTCATGCTGGCTAGATTACAGAAGTACAAGAGGTGCGCCAATTTGATTTAGGATTGAGCCAAG
TGGAAACCAAACTCAAACCACTTGGAGCTGAATCTGGTGGAAGCTTGGTCCCGTCCACTGCACGTACGAATCATGCTTGCTGTCCATAGATGAAGACCAC
CATCAAAGGCTTCCATGTCAACGCCACCTGTAAATGGCGCGCGTTCCCAGTCCTGGACCTTTGTCTGTGTTGctACAGTATTCGGCACTAAAAAaCTCCA
AATCAACAAGGTCAGACACCCTCTCTAGTGCACTGTTTCCGTACACAGTATCTCTGCCTGTATCTGATCGACCGCGGTAGTGTCGACAGCTAGTGCACTG
CGTTGAAGAGATAAAGTTCACTGTGAGACTTGCCAACTCCATTATTATCCCGATACTCGAGCAGCTCGCCCTGCGCCTGCCTTCCACCCTGACATACCTC
ATCACTTGGTGGTTTCGGAGATGCTTCGCTTCATACAAGTACAGGAGTCCTATGACTCTGTGCAGTATTGGCGTGTCCTCGTTGAGGTCAACCAGGACAT
GGGACCCTGTCACAGTTGTGCTGGCAGCACCTGGCAGATGgCAGGCAGGAAGATGCGACGCCATGTGGCCcAATCGCTTCAAGTTCCACATTGGCTCGAG
TGTCGAGCCTAAGTGAAaGCGCCTTGTTCGGTGACTCGCCACGCCAAGCACGCACGGCAGACGAATGTTGAGTTGACGTTGCACAGCTGGTAACGAATGA
CCAACGTGGAGATTACTGAATTGAATGCTGATATTGTAAGCATTACAGGACCGAGCCTGAGTGACTGCCCCAcGCCTGGCTGGCCCGACACAAGGCCCAG
GCGGTCAAGAATGTCCTGACGCATTCCACAAAGTGCCTTCAAAGACGCACATAGCCAAGATAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
TGATTCAGTTCTTGCTGACGGTGACAACGGTAGTGGCGGCA