Description :
Non Conding Region
Location :
Scaffold_1:141399- 141729
Sequence
330 bases(100 bases per row)
AGAGCTTCATTTAGTCACAGTACGCAGCGGCAGCTGTCAAGGAAACGGTGGGCGATCGTCGTTGACTCCTTTTGAGTTCGTTTACCCACATTACTTTGAA
GGAAGTGATCTTGACTAAGAGACCTCGTTGGTACCCACTTCCAATAGTTGTGTTAAACGAGTATTCAGCTTTTTATAAAAGCAAACCCTGTCTTTTTTGT
GTCTACGTTTACATACATTTCGGCGCGGACACATTTTTATGCATCCGCTTAAGTAACGTCGTACGCTTGTACGCCAAATCTGAGTCCGCAATCCCCGGTT
CAGTGACGTCTTCTCGGCCCAGCACAAACA