Description :
Non Conding Region
Location :
Scaffold_1:141234- 145313
Sequence
4079 bases(100 bases per row)
ATTTTTAATGGTCGATTGGGGAAACGAGAACGAGGTCACGTATGTCCCAGAATGAATTGAATGAGTTTCAATGATCTTCAGCGAGGAAATGTAGCTGGTG
GCATTTTTCATGCTAGCGAAGCGGAGATGCAGCCGCGTTGGATGCGATCATATcatgctgttgttgcttgtaAACACTAGTAAGAAGCTTCTCGCGTTTC
TTGGGCTGGTTGTACAGGGCGCAGTTGTTGGCACACATCgttgatgacgatgttgtAGTTGGTCCAACTTTTCCACACGAGCATAGCGGAGGGGTTCCCA
ATTGCACTTGAAGTGCTCGAAGGAATCGCTCATGCTCCTTCGTTGTTGGTGATGTCGTGGGGCCGcttgtttttttcttcctagtgaagttgcagttgaa
aCATTAGGACGGACCCACAGCCAGAATTCACATGCACATGTACTTACCTCCACGGAGTTGAGGATATCACGGTTTGGCGATGCACTCGCACTTCGCACCC
TGACGTCATATCCACGCTGCTTACAGGAGAAAACAATTAACAGGAACAGAGGCTGAAACCAAGACACTGTATCATACGATCAAAGGAGCGCATTCTCGTA
CACTTTGACTCCCGTCGAGGTTGGGCATCGCCCCTCACTACTTTTTGCACCCGGTATGTTGGTTCGACGATCTCTACTGCTGCGTACAGCAGCCGCAACT
GAATAATTGTGTTTTGGCGACCTAGCTTTGTTTGTGTTTGGAGGCTTGGGAGTGTTTTGCCAAACGCTACTTTGGGCTTTAGCTCGATTCATCTCCATGT
ATTGCCGTCTCACCGTTGCATACAATACAGCACGCTAGCATATCTCAAAAATGTTAACACAACCAGCAACTgactacttcgaagtatcCTGTCATTTTGA
CGCACCTGCTCTGGAAGCAGAACAGGAGATTTACCtgtcttggtgttgtttttgcCTCCCCCATTTTCGTGGTCACTGTTGGTCGATTCCCCCTCTGAAC
GTGAGATTTCAGTTGATCGAAGAAGATCTTCACGGACTTGGGCATCTGCACGCAAGACCTATGATACATATGACCTCTCTTTCAGTGTTGACAGAAGATG
GGTGCTCTGACAGAGTTGCGTTGCTATACCTTTTCAATTTGATGACCCAGGGGGAAGTCCTGGTGAAAGTTGTGTCAGACAACAGTGCTACACGCTTAGT
TATAAATCGAAACAAACCTTCAGGAGGGCTTTCTTTTGTTGCATCAAGTCACGGAAATACGAACGAGTTGAAGTTCGTACGGACGGTGCGTTTCCGTCCT
GTTGCCATGACATTACAGTCGAAAACGCCTTCGCGCATTTTTCGTCCTGCATACAAATCGCTACAAGCATCAGTATTGATGTATAGTTCTGATAGATATC
TGCTGAGAAAACACGCACTAAATACTGCTGCGTGCGTTTGGCCTCAAGTCGACTTTGCCTCTCTCGCTCCGTCACGCGAACGCAGATTTTCTCGTGAAAT
CGTTTCAGCTTGTCCGATTTCACTTGCAATCGCACTTCACTCTCATGCCGTATCGACTCCGTGTCAGTCTGTATACAAAACTCAATGAGATGCTCTTCAT
TTGTCATAAGTACTTTGAGCTGCCTACCTCCACATCACCAAAATCAAAGATATTGATttcttcgccatcaacgAAAGCTCTGTCGTGTCGGATAGTTAAA
AGTCAGTAAAAACTTTCAATCAGCCGAGTCCCTCAATTGTCCAGGTGGCGTACTTGTCAGGTTCTAGTCCAAGGGAACCAAAAGCGGTTTATAAGCTACC
AATTCATCGCACAATACTGATCATTGTCCTGGAGTTATCTAGAGTGAAATAAATGGCTGACAATACGCACTGTCGGGGTAGTAATCTCCATTAACTGCAT
CGTTCATCCTAGTATCAATGTATGATCTTGAAACGACGCGAACTTGAAAAGACGCAAACTCCACTTGCTAGGCTTTGGCTCAAGTTATGCCATTGACTGA
GTATTATCACGTACGCGACCCCATCGAGAATCTGTTGATCCATGTCACCCTACGCAAGGTTAGAATTAATTATGCGGAACAGAGTAAACGATATTATGCA
AGTGACTGTCGTGTCTGGATCAATAGATATCTGGATTCAGAAGCGATGACACCAAGGACTTGATCCCCGTGGGTAGAACGTGGCGACATCGCTTTCGATG
GCAAGAGAAAAAGCTCAGCATCAGGTAGAGTGTTTAATCAAGCGTGGACATGCTTGAGGTGTTAACTTTTGTTTAATCTTCTGTAATGCACACGCAACAA
GCGAAAAGAAGCAGGAACAAAAGTGCCTGGAAGCGAGAGGAATTCAACTATCAAGTAGAAAGGTGCGTATAATTCATCAGCAGTGCAAGAAAACCTGAGT
TACTGCTAACCGTCCTCGAATTTCTCTCACCGTTAATTACCAGTACGGGGATCGAAAAGGGTCCGAGTCTGACATTTCCGATATTTTGTCTTCATACGTC
GACGTTGATGATTTCATCCCAACAGAGGTAGATGTCTCTTTTTCTCTGCTATGTTCAATTGCAATCGGTTAACGCGTTGCCTACAAACCAAGTTTGTGAA
GGAATTACCAAGTACTTCAAAAGCCTTAACTCATTTAGCCCCACCTGATCTCAACCGAAGGCCACGCAACACTAAACACCCGACGTTTTGGACGCTAAAC
CACCAACGCACATGGCTTCGTTCAAACCGCGAAGACAAATTCCGTGCGATGCACCTTGTTGCGTTTATCGAAGGAGCGCAGCGCGTATTGTGCTCATTGA
GATTTTACAAGGAGACTGGGCTACTCTGCGCTACACCGGGGTTTTCCTCGCCAATTGTGGACCTTGAGAACGATCCGGACTTGTTGGTGAAAGGGCCTAA
ACTTGCGACGTACCAATTGAAAACGCACTTGGGATGCCTCTACGAGTTTGTGATTGACAACACTAACGATTTGCTACCGTTCGCCTCCGCCGGGGACCAA
CGGTTGTCTCGGGAGCTCCAattgcaagaagagaagcGCGATAAAGCAGAAGTCGATCGCTGGGACAATGTTGGGAAGAAACCTGCAATTATTGTCGCTA
ATAGGATGCAGCAAAAAAGAATGCTGTCCTTGGAAATGGTCACCATCAACAATTCGCGAACTACCGACCCTATCTTCGTGGAGTATGAACTTGTGTTGCC
TGACCACGGATGCTATCCTCAGTGGAGATTTCAAACGGGGGATCTCCATCAAAGGCAGGGTACAACTCCGTTGTCAATACCTCAGAGATCTGGATATTTG
TGGTGGACGTCGACGGCAGCGTTTGGATGGCAGCAACACTTCAAACTAAAACTTGCAACCGAAAGACCTCTTTTAGCCCCCGAGAAGCATGCTCAAGAAA
ATAAGGGATATtcctttgctgctgctgctccaatcCTGCACTTGAGAGTTTATTCTCGAGATTCATGGCAACGAAAACGAACGGAAGGCCACGCAGAGCT
TAGTCTCCAGGAGTCGACTGGATTCTACGATCTTGACGTGCCAATTCGAAGATCTATTCTCTCCACCCGTGATCAGATGGAGGAACTTTTTATCGGTATC
GATGAAACTTACAACAGCCAAATAGTCAAAGGAGACCGATCTCACCACCATGAAATTCTATCCGATGAATCGCCAATCACGAGCATGATCACGAGTCGAT
TAGGACAGAAATCGGAATCGACTGACTCCACGATACGGGTCCGTTACAGCATAGTTGATCTGTGTTCACCAAAGCGAGATGTTGGTAGCAGGGCAAGTAG
ACCATCTCCTGAAGTCGCGGTTTCATCCAAGGTTGGTACACGTGTTGTGAAGCGAAGTGTACAGGAAATCTTGCAATCGGTCAAACTGGAGAAGCGGTTA
GCTAGCATAACAGATACTCGTGTGCAGGCTGCATTACGCCCCATGCCTTccgatgctgcagctgcagctgctacaGTAGCAGAGGCATCACCAATAAATA
ATAATGCCTCACTTTAGTATAACGTGACACTGAAATGAGAGTTTATTCTGAAAATGAACAGAAGGGAATAAAAGCGCCT