Description :
Non Conding Region
Location :
Scaffold_1:141150- 141305
Sequence
155 bases(100 bases per row)
aagcacctagcaaacgatagtaaagcagaaggagagaagggagaagaaagcctcccttcatgtcatggttgcctttcacttcaacatcatgtatgccaca
tcaattctaaaacaaattaatttttgagcgaaaagtacgagccattgatccaaaa