Description :
Non Conding Region
Location :
Scaffold_1:141124- 141339
Sequence
215 bases(100 bases per row)
CACCTAGGTGACCAGGTTAAACCCTGCTGGTCCCAGACGGTGCACTGAAGCGCTATATCATAGTACATAGGATTGCACTGCAAATGACGGCGCTATTCCA
CCTCCTCGTCTTCCTCTTCTTCTTCTTCCTCGTCATCGTCGTCTTCCTCCTGCTGCTCTGCTGCCAGCTTCTCACCTGCAATTCCAGCAGAGCCATTGTT
AGACACATGAGCATT