Description :
Non Conding Region
Location :
Scaffold_1:141087- 141215
Sequence
128 bases(100 bases per row)
tccgatcacaaagtgtccgaaaacgcatgcgtccgcctcggttgagaaccggccttagGTGAGCTTGCTCCAACGAACGCGTCGCCACCCCGCTGGGTTG
CCAAGCTTGGGCTGAACAAGTTTGAGCC