Description :
Non Conding Region
Location :
Scaffold_1:141085- 143544
Sequence
2459 bases(100 bases per row)
ATAATTTACTGTGAAGCGATTGTTCATATTTGTCGTGTTGGAGTGAATACAATTTTACATATTAGGTGCATATGCTCCAGAATCTTATATAGAATCCGCC
ATTTTTGACAAGTTGTATCATTTAAATGTATCGTATTGAATCTGCAGTTTATAATTTTGTTTTGCCACTCTATCCACTCCAAAACCTTATAATACACGTT
CTTTGCCGACTGCATCGTTTCCCCTACACTTTGTGCAAGTTTTCGGATCCTTGCTTTCTCGATTTAAATAAAATAAAGGGCGACGTCATCCACAACACCA
CGTGCAGTGTACGAACTTAGCAACCTAGGAAAAGCTCGCAGAATCGGCTCATGACTGTACCGTGCAAGTTCTGGAAATTTTTGTCGAAAATAATGTGTCG
CCATTGCTACTTTGTAATGAGGAATTGTTGGTAATAAATGGTGTATCTGATGTAAACCAATATGATGTGTCATATTATCGACCAGTGCACCATATGTTCG
ATCCACACTCGATAAATTCCCACGTACATAAGACCACTATGTATCGTCGTACCACGGTAAGTCGTCATCCACATGGTTCTATTTCATATCGGTGCAGATG
ACCCATCATCAATACCAGTTCAACCTCATACAAAAACGCACTTACCAGAAAGGTCGTGATCACCAGCATTGATGCGAAAACAAGGATCGGAACATGGTAA
TATAATATCATAACTCTCCAACCAATGACGGTACTAGTATAATACCACCAAACACAGCTTGCACCATAAGCGATATAAATACTTTCAACTGATGACGCGT
CAATAGTGGCTCCATGTATCCACTCAACATACACAAATAATAAATAATAAATAATAAATAATAAATAATAAATAATAAATAATAAATAATAAATAGTGAT
TAAAACTTCGCGGTGGGAATCCATTGATCAAATATGCAAACCATACAAATCCCAAGCCTGAAATCTATATAAAATACCCATTAGAAGATCAACTGAAAAA
CCTTAATACAATCCTATAATTACCAAACTTCGACTCAGTGGATGATTATCATTGGCTCGATGTGAAATAGTCGACATCTCTGTCCAAATGACCCGTATTT
TTATGATGTAGACGATGTGAAATTTTCCAAGGTTCATAAGGTGTTAATGCGATAGAGTGTAATAATAGCCCTATTGTATCATTAAGTATTGTGTAGCGTG
AGAATGCTCCGTGTCCACAGTCATGAGCAAGGGTAAAGATACCCCAGAAATTGATTCCTTGGATTATAATATATCCACAAGACACAACGGCGTTGTAGGT
CCATATACAATAGATAATTGGGACACCACGAAGGTAGTAAAGTGTATACATCAGCACGATGGCGATTGTGAGTGCGCGAATGATATAATACATTGACAGC
AAAACGGAGGACTCAAACTATTCCTTCGGTATCGCACTTTTGATTTCAACAATGCTTGGGATTTTTTGCAGTGGAAGCGTAGTATACGACATGCTGCAAG
TATAGCAAGCATCCGTGTGTAGATTTCGTTGCGTTATGTCAAAATTGCAAGGATTTGACATCAATTAATAGTTTCGAAATGAGAGTTTATTCACGTTGCT
TTTTACAACCACAGCAGTGGTATGGATCAGTAGTACATAGCTATATAGTAACAATGTTCGATCCTTATTTTATTACCAATTCTGGAAAAACCACGTTGGA
GGCAAGATGGCCAAATAAAGCTCAAACAAAAAAGCCAGAGTTTTCCAATGCAAAAAACCTTTTTGTCTCCAATGGACCCTACAATCATTAGTATCAGCTC
TACAGCGAGTATGCTCCTTCGGTATGGTATCCCTCCGCGATATCCATTACTAGTGTTCCCATCAATCGCGTCGAACATCGAGAATGTCCTGTGAACAAGT
GTCTGGGTTCTTTACGTGGACCGTAGTACCCTGCCCCTGTGCTGTTGTCTGCTATCTATAATATTCTATCAAGAGTCTCACGATGCTAAAAGTGGGGTTT
TATACCATATCTCTTGTTGTTTCTGATACATATCCTAAAGTATAATTAGATTGCACGTGCGTTTGTGAGCTTTCTGTGTCTTTTTTTGTACACTCCTTCC
TCTCTTATTCATACACGGTAAAACCGACCTCGGATTATAACATGTGAGAGTTTTTTTCAAAAATAGAGGTATCAGATAATACAGGTCAAATTGAGAGCGC
CGTTACGTGAATGACATCGCAGATGCCCTCCATCGCAACGTTGCTCGGAAAGCAAAAAGCACGACAATTTAAAACAGAACAGTCAGTTTGATAGCAGTCT
TATTGAATGTCTTCCAAAGGAAGCCTCTCTAAAAACCAGTAGCTTGTATACAACGTCTGTTTCATTACCATTTTCTGTTAAATCTTTTTGCTTTTTGTTA
TACACTGTCAACTAGTTCGTAGATGTCGTCATCTAGGATTCTAGTATGCCGCTAGCAGA