Description :
Non Conding Region
Location :
Scaffold_1:140934- 141149
Sequence
215 bases(100 bases per row)
TCGGATACATGTGCTTACCAGAGTGTAGCCAAGGTAACGCGTCATACAGGTATGTAGGCCCAGCAGGTCAATAAACGCTGCAGGTGACAGCGCGAACGAA
GGTCCATGTAGTCGTCCCCCATACAGAAAGCGCATTTGAAGCCACAAGAAAAAAGAATAGCGGATTTGTACCCAATCCCATCGAGCAATCGACCACCAAA
TGCGCGTTGATTGGC