Description :
Non Conding Region
Location :
Scaffold_1:140795- 143353
Sequence
2558 bases(100 bases per row)
TTATGCGAAGCGTGTTCAAACACTTTTTGGGTCCTTGGCCTCCGAGCAACAAATTGTCGATCTCCGGCAGCAGCGGCTTGTGAATACCGGTTCGCTGCTC
TTCAAGGGGGGCTGGCTCAGTAGTGTGCATCCCACTTCTGGATAAAACATACTGCTCATCTTTGTTGCATTTGATCCGTGCCACCGCAGCGCAGTCGACA
TGAGACGTGCACGATAACAGCGTCGTCGTTCTCCCATTGATGTCGATGGAAAAACGAGCGTTCTCAAGCCCATCCAAAACTGCCCTTGCCTCTTCCATCG
TATCGAACAGCACCGGGTGTGCCATGACAGCTCGTTCACTTTCATCGGGACGGGTTTCTGGAGGAGTGGTATTGTCTTGCTGCGGTGGGGAGTCGCCACT
GCTTCCCTCGTTGTCACTTTCGTACTCGTAGTCCTCATCACTGCCACTTGGCCTTTTACCAGCCCCGTCATCGAAGTCGAGTTCGGCGGTCTTTTCTTCG
CTGTCAGCACTACGCTGTCTGCGACACAGAATGGCGGCTGATCGACATCGCGTTACCACACCCGAAAAATCCTCGCTATCACTTGAAGATGGGGTGAGCG
ATATTGAGGACGGGGGCCCGGTAGAGCGGCCGGTCGGTTCGGTCTCCATTCCAGGCACGGTCGACGCCTCGCAACAGTAAGCGGTGCGTTGGCAGCAGTC
TTCGATACAGGCTTGCAAAGGTCGGAAAGGATAGCCGGGTGTGGAGGTCACGGACGGGGTTGTTGACAGTAGCTGAGGTAAAGACTTGTTCGGATGCTTG
GAAATTGTAAACTGAGAGGTCTTAGCAAAAGCGCAGGGACCGCGGCGGTTGTATGTCCAGTCTCTGAGGTAATTTATGTGTTTACTTACCGTACGAAAGC
CGGAAAAGGTAAAATTTAAATCCAGAAAGGCCCAAATTAAATCAACCTAATACAAACACAGCAGTTCAGAACGTATGTATTTCTTAACGGAAAAAAGGAA
AAGAAAACAGAAAACTTACTCGCTATCGTAAGTTAAATCAACTGGATTGTTCGCAGACCCTGCCGTCTCGATCTTGTACTCTTCTTCGCTTTCATCGCTT
CCTGATTGACTGAGCGAAGGGGACGAGTAATCCGATTGGCTAGGAGAGGCATCAGTAAAACTCTCTGATCGGTCAGAAATGCTAGGAGTGCGCTCGGATT
GACTGAAATTGTTGCGCGGGGGTCCTGGTTGGCCAAAAAGGATCTCGTCGTCATCAAAATTGTCGACAAACGGTGGGGTTCTAGGCCGAGACGAATCATC
ACTGCTCTCGTCGGACGATGACGATAGTGGTTCGCCATCGACTTGGCGCAGGGTGCGCGACGCGTTTCTGTCGAGGCGGGAAATTTCATCGGCAAGGACC
CGCTCTGCCCTCAACAGGTCCTGTCGGAGGCGGTCGATAACATCGACGGCACGGTCGATCGAGGTTCGCAGTCGCTTGATTGGTCGCATCGCAAATGCAC
AGTGACTACATCAGTCCGCCGCGGCAAAATCCTGTCCTGTAGATAAGTACAGTTGTGTGGATAGTTAATCGTGGAATAAACTATGCAAAGCTCTACTTTA
AATCAACTACAGTACTGTGTAGTGCGACTAAGTGACAGTTGTAAATCAAGCCTACAGTACACCCAGAGGCTTGGTAGCAGTCATATATCAAGTCTTCCGG
CCTCTTCAATGCATGTTTGTAGTCCATGAAGGCTTAGTAGCGGTGCATATCCGAACTCCAACTGCTCACGGAGCTGGCGTCTAATTAAATTTTTACTGGC
GTCAAAAGTAGCTGTCGATAATAGAATTAATCCTATGTAATACAATAAATCCCCATGTAATAGAAAGTAGCCGATGGATGCATAAAAAAGTTTCCCCTAA
ATATAGCAATACATACATAATCTTATCGCTAATGTTAGATTGTTTTTTTGCTTTTGGCTAATAGTCTGGTATCTCTAGAGCGTCCGAACTCGAGGTTTTC
ACACATCCCATGCGTAAAAATCTTATCCATAAATTTAGCAGTACAAATGCACTCTTATCGCTAGTGTTAGGTTGGTATTGTGGATCCAGTTGGTGTCCTG
ACACTTCCTGGAGGTCATTCGCACAATTCCCATCAACCGACGACGACCTGCCTTATCGACTACCGACTATGGAGTTTCTCAGCCCAAGGTCATCCTCCTC
ACAGGCATCTGGGGACACTGAGCCGTTCCCTTCGAGGAGTCAAGCGACATGGATGAGCTGTTCGAAGTCGGAGAACAAGATGGTGGTGAAGAAGAGGCAG
GCAGTGAAGAGCAAGAGACGGAGTTAGAAGATTAAGAGACGAAGACAGAGGAAGCCGGTCGCGTCAGAACCGGGCCTATCGACTACAACGGATTCTACTA
TGCGCGATATCACGACTCCGCAAGATCAACAAACTATCGGTGCAGCTCCCACAAGCGGACCAAGTGCAAGGCCATGGTGTACCACCGCGCTGACGGGACC
ATAATTCAGAGAGGAGAGCACAAGCCCGGCTGCAATCGCCTGCAGAAACCTACTTTTC