Description :
Non Conding Region
Location :
Scaffold_1:140771- 142036
Sequence
1265 bases(100 bases per row)
TTCCCGCCGAGCGTCTCTATCAAGATGCCAAAGATCTAGGATCTCGGAGGTTGCCGCTGCCACCCCACATGAAAAGCATGGCCATGCCGGTAAATAGTTT
CGGTGAGGCAGTCGCCGAGGTTTTTTCCGCGGGTGCCTGGGTTGTTGGTCCAGGGGGAAGCCTCCCCTCTCCACCGTGCACCTTCTTTCCCGTTTCTCTC
TGGCACTTCCTTTGTGGGGAGAGCAACCGGCGACGGAAAAACCTCAAAGCGGGTGGATCCGGCCGCCCATTGGCTCGCGTGATACAATTCCACCAATCAC
CGCGCGCGCACTGCTGGGACTGCCCCTCAGCCTCATTTCCACGTGCAGGAACTGGCACTCTTGTGGCTTGCTCGCATCCTCGCCGCCGNNNNNNNNNNNN
NNNNNNNNNNGTACTCCTGTCGCTGGAACAACGCTACACTCGGCCGCCTCTAATTCTGCAACGGAGCGACGGCGTGAACCCGACGTCCCTATTTTGAGGC
GAGGGATCATCACTCCTGCGCGCCAGCAGCCACCGACGGCAGTCTTGCGCTCACTATATCGACCCAACACGCGGCTCGAAAGCGGCCGGACTAGTTGTCT
TTGCGCGCTCGCCCGGCCAGAACGCGCGCGCTATATATGGCGCGGGCGACACGCGCGGCTCGGCCAGATCGCGCGCTTTCGATCGCGCTATTCTCGGTCG
CCGGGCGAGCCGTGTGGGCGGAGGTATCCTCGCCGAGGCGGCGGCGCCGAGTTTGGCTCGGTTGCGCGGCTTGGGATTGTAAATAGCCGATAGTGCGCTG
TTCCATGGGGAAAAACCTCGGAGCGAGTGAAGGCCAGCGCGCGCGGCGAAGGTTGCACTCGCACAATCTTCAACGTCTGGCCCGAAGGCGGGTGGTTATG
TAATGGCCCGAGGTTTTTCAGGGTTTTATCGCGCTGCACGCGCAAGCCCATACATTGTGATAGTACAGCGCGCCACCCCCACCCACGCGCGTCGCCCTCG
CCGTTTGCAGGCGGTTTTTTCCTCGTCGCTCTCGGGCGTTCCCCCTTGGCGCTCGCTGAGGTTTTTCGCCTCGCCGAGCACAGGGCACGCCTCCTTTGAT
AGCGCGGCCGGGGTTTCTAGGCTCGGGTGTGATTCCCAGTTCAAATTTCCTCGGCTGCCAAGACAACAGCGCGCAGTATCGAGCGGTCGGTTTTCTGAAA
TTTCAGGAACCTTCACGCTTATTTTTTCGGAAAACCTCTCCCCGTTTGAACCGGCAAGTCGAAAA