Description :
Non Conding Region
Location :
Scaffold_1:14077- 14959
Sequence
882 bases(100 bases per row)
CAGAAGCCTGTGTCATGTTGGCGGGGGATGACTTTGTACGTTCATTTCGATAATCAATGTGCATTTGTTGATTTGAAGAGCTGTGGCTTTGAAACGCATT
GCAATAGAATGCAGAACTGCACACACAGGCTGAGCAGTTGACATACAGCAACGACCTGAGAGAATTTGCATATTTGACGGGGAGTGAAGGATTCTAGAGC
GTGCAGAACTGCATAGCGCTGTTTAGTACGGTACATTGCTGTGTGGGTACATTCGACAGCCGAGTTGACCAGGTTAACAGCATGAACACCGACACATCCC
ACTCGCCCGAAGTCAGTCCAATGCCCCCGGCTGGCGCCAGGCGAGCGTTTAAAGATGTGTGAGCGGGGACAGCGTCCACGCATCAAAGGGCCGAACGCCC
GTCTCGAAGCTGAGCCGTGGGCTGCTCCGGGTCAAGGCGACTCGCTGCTCGCCGTTCTCACTCGTCAGCCACCCGCAGACACACGCTGCGCAGTCGAGCC
ACACGATTCGCTTGTTCCGCTGGTCCACTGCGCGTTTAACAAGCCAATCGCATGTTTGAATGAGTCAGACGTAGAGTTTAACAGCAACAGCTCAACGATT
CCCGACAAAACAGCAAGGTACTGACGTATGTTATTCATGCCTTTTGTCTAGTTGGTCACTGGCACGTGCGTCAACGATGCGTAAGAAAGACCTCCACTAA
CACCGGGCCGTCCCATCACCCAACCGCAGCCGATCCAGTGTGAGCGCCAGCGATCATGTTTGCGTCCCTGGTTGCGAAAACCGTTCGCAGGAGCTTGCTC
CGATGCGTTGACTTGCAGACTGACCCTCCTGGAACATTGGTCTCCTTCACTATTCAATTCGCTCCTCGATTCGCAAGTACGA