Description :
Non Conding Region
Location :
scaffold_1:140608- 140759
Sequence
151 bases(100 bases per row)
CGGTTGCTTCAATACAATCCACCATTACAGTCCATAATGGCCATCAATTTCGAACAGATCCATTGCGTTCCATAATGGAACTTTTGTTCCATAGTTTATG
GATGTGAAATTATGGAGCCATTTTCCTAATGGTAATTTCCAACAAATGCAA