Description :
Non Conding Region
Location :
Scaffold_1:140431- 140618
Sequence
187 bases(100 bases per row)
GACTTCTGATTCTCGAGTAGCTTCTGGGCGACAATAGTTGAACTTGCAAAGTGAGAATATTTACAGATCTCCTAAGATTTCAGTTGGCAAAGTATCAGTT
TTTAATCGACATCTTAGGACATATACTTTACGTTGCGACAAAGTACATCTCTTCATCTGAAAGCTCTGCAATGGAGAAACTGCATCC