Description :
Non Conding Region
Location :
scaffold_1:140207- 141252
Sequence
1045 bases(100 bases per row)
TGCTGCCACTCGTTGATCCTACTTGCTGGATCAAGTCCACACCATGTCGCAGTTAATGGTGTATGTTACATCATGCGGTGTTGCACACACGAAGTTGAAC
GAAATGTTGCAGATGACGCTTGCAGGTGCCTTCCGTCGTCGCGAGGTGGAGCCCGAAAGCGATGATCCCTGACGTTCATGGCAATGCGCAATATGCTCGA
CAGCTAATCTAGAAGACCCTGATAGCCCGTCGGAATGTTGCAAGGTGTGCCAGCGCTTGCGTAGTCCGGTATGGTTGACTCGGATAATCAGGTGCTCAAT
TGATATTTTCCTTCGCAGTGAATATTTTGGAGTTAATCTATTGCTACACTAGGTCGTGTTAGGATCCCGAGTATTTCATACTAGCGTCGGTGGATCCAAA
TCTGTGGCCGTTGTCGTCGCTATCAATTACGCTCAAAAAGCCGTCACAATACTTCGAGCAAAGTCGAACGATGGGGTTGATCATAGAGATATTAATTTCA
ACGAAGTTATACTGAATGCGACGCAAATACAGCAACAGCTCGAGATTCTGGATGCCGAACAAGAGGATGCCTGCGTAATAGACAACTACGGTGTGTGTGG
AGACTGCCGTAGCGTCTTTCGCGTTGTCCAGCGTGACCCACAGTCCCAGTATGCGGACAAAGAGGACGAACTGCAAAAAGAGCTGCGACTGCTGAACGAG
CAGAAGCAACGGTTTGTGAGGGATAAGGCGTACGAGAAGACCCTCAAATGTACTGATCAGATCAAGATGAAAACGAAGCAGCTCCAAGTCGCGAGCCGTG
AACTAGAATTCCTTCGTCCTGTGTTCTGTCCATTCTGTGGATGGTTCGAGCCTGATAAAAATTATGCATGAAGACTACGAAGGAGTAGGGAGCGACAATA
TATTCCCCTTTAAATACTCAACGAGAACGCTGTCGGTCCTGTCGGTTCGATGGCGCGTCCGGTACAGCCACGATTTATCGGTTGCATTGGTCGTTATTAA
AGTGAATAGCTCTCTCGGACGAATACGCTGCAGTAAATCGGCCAT