Description :
Non Conding Region
Location :
contig_1:140129- 140944
Sequence
815 bases(100 bases per row)
GACTCCGACGCTAACGTCGGAGGATTATCCAGCCTCATCTTCTTGTATTGGAGACCAATACTTGTACGCGTCAAGACACTCAGGGTCTCGACGCTTGTCT
CCAACTCCTGTGTCTGTTCGGCAGACACTGCTTGTAGCGTCTAGGTCCCTGATTGGGACCTGCACAGCTTTTCTCGCTTGCGCCGTTCACTTCTCGTGCG
GAGCCCGGCTCCGCGAGTTTCTTCTTGTCCAGGCCCGACCGTGGTAAGATATTCCTTGTATCTGCTGGCGAGTTCTACCCGCGGGCGCACGTGTTCAAGC
CCGGCTTGATCGTGTACCTCTTCGTCGTGCAGCCCGGCTGCACGCGAGCTCGCAAGCATTTCCGGTGCGGGACGTTTGCAATCGTCCGCACTGCTTGTAG
CGTCGGCTCACAGAGCCGACGCGTCTTCGTTACCTCGACGCCTAATGGCGGAGTGTCTTTCGACAAATTGTGTGTCGACATTATCAGTCGACACGACCGC
GTCACTCCGGACGCTTCGAGACCTTCTCGAATCCGATCGAATCAGGCCCTGCTGATTCGGTTCATATTTTCTTCCAACGACTCTCGCAGTCGTTGTTGTT
CCCTCGGGGTGATTCGAGACAGCCGCATTCCGCGCTGTCTTTGATGGAGGGACGCATGCATTACGTGGTGCATGTGCTGCTCCCGAAGTGCATGATCGTG
CGCTTCGTCCAGTCGATCACCGGATCATGCCGTGCAAGCCACGGCATGCCCCATACCATATCGAACTTCTTCTCTTGATATGAGAAGCGTACACGTACGA
TACGCTTCTCGGTTC