Description :
Non Conding Region
Location :
Scaffold_1:14011- 14726
Sequence
715 bases(100 bases per row)
AGTGATCTAGGACGAATTGGCTAAAATGGAGGGCATTATCGGATCCGCAGGCCAATTTTACCCCAATTACGCACACAAAAAATCTATTCCAGCGACGAAA
ATGGAGGCATCTTTTTCATGAGCTCTTAACTTTTGGGCACGATGGTTCTAGAAGACATGCATGGACTCAAAATGAAGAGGAGATACCCAGCTTTCGAATT
AGGTGCCTAAACGGCGATTCGTACTTTGGTTGATAAGTATACTTTGTTTGACGCTGTCTCAGATGTGAAAGTATTATGAGATAAAGGAGACTGTACAAGC
CTTAGTGGGAGTGTTATTACATTCGTATTGGTCATGATATATGATAGTTTTTGCTGCCAGTTAGAGGGAGACACGCATCATATTAAAGAGGTTATACTGG
GATAGGAAGGCTGATAGCACAGCCCAACAGTTGCCTCGCTGTCTGTCCGCCTGATATCGGTATATCGGTATTCGGAATCTACTGAGACTCCGCGAGGCTA
GGATAGAACCTAATCGACACTAACTTCAGGTACATGTCGACCATTCTCGGGTAATAAATGCCGCTGCTAGCCTAGGGGGATGGATCGGGGTACACGTTGA
CGACGCCCAGTTATCAAAAGTCGCCTAGCTACTAAACATGTTAAAAGACTGTTCGAGGCGTGGACGAAAAGTAGTAGTAGTTAATTAACGCAAGAAACGG
CCCATTGAAAGCATT