Description :
Non Conding Region
Location :
contig_1:140083- 140744
Sequence
661 bases(100 bases per row)
GACTCCGACGCTAACGTCGGAGGATTATCCAGCCTCATCTTCTTGTATTGGAGACCAATACTTGTACGCGTCAAGACACTCAGGGTCTCGACGCTTGTCT
CCAACTCCTGTGTCTGTTCGGCAGACACTGCTTGTAGCGTCTAGGTCCCTGATTGGGACCTGCACAGCTTTTCTCGCTTGCGCCGTTCACTTCTCGTGCG
GAGCCCGGCTCCGCGAGTTTCTTCTTGTCCAGGCCCGACCGTGGTCAGATATTCCTTGTATCTGCTGGCGAGTTCTACCCGCGGGCGCACGTGTTCAAGC
CCGGCTTGATCGCGTACCTCTTCGTCGTGCAGCCCGGCTGCACGCGAGCTCGCAAGCATTTCCGGTGCGGGACGTTTGCAATCGTCCGCACTGCTTGTAG
CGTCGGCTCACAGAGCCGACGCGTCTTCGTTACCTCGACGCCTAATGGCGGAGTGTCTTTCGACAAATTGTGTGTCGACATTATCAGTCGACACGACCGC
GTCACTCCGGACGCTTCGAGACCTTCTCGAATCCGATCGAATCAGGCCCTGCTGATTCGGTTCATATTTTCTTCCAACGACTCTCGCAGTCGTTGTTGTT
CCCTCGGGGTGATTCGAGACAGCCGCATTCCGCGCTGTCTTTGATGGAGGGACGCATGCAT