Description :
Non Conding Region
Location :
Scaffold_1:140073- 140289
Sequence
216 bases(100 bases per row)
CCACCAATCAGCGGCGAGACAGGATATCCATTGCCACAGGACCTGTCACATTGCATTTCGACGCATTCGAAATCGATTTTAAAAGCATTTTTTATACACC
CCCAAGGTCACCAGCATGGAGAGCATTGTCGACGGGGAATCGAGGAGACCAAGGCAAGCAGCTTGGCCGTACGGATTGCTGCACAAAGGAGTCTGGGCAG
ACAAGGCTGCTCTCTC