Description :
Non Conding Region
Location :
Scaffold_1:140015- 142772
Sequence
2757 bases(100 bases per row)
CTGACCTACCGCCTGACTGTCTTCGTCGTGTCAGTATCTGGAtGTCACTAATCCGGATTCCCACTTCAACTGACACACTGGCAGGGATGATCATAACTGC
TTAACTGTATCAGAAGCTTCGCTCTCGGTGCTGCATGGGTCGCTAGACACTAAAGATCTACGCCTCCGCAAACTACTGAACGATATTCATCTCACAACGG
TCGTTGAATTACTGTTTGTACAATTGCAGCAACCAAATTGTCTCCTCaTCTCTATCGTCGTCTGAGTTGTCAAGGTTGATGCTCAACTTCAGCACCACCG
ACTCTACAGGACATGCTTGGGCGTagACACTTTGTCACGGCTTTTACTtCGAAGAACACGCGATTCACTGCCATAGGTgCCCGCGGAATCCAGTCCGACT
TCATGTATCGAGCCTCAGAAGTGTCACCAACCGTTGACCAATAGCCcACGTGCTCcGACGGTTCTCCGTGATCACCAACGAGTAATCCCTGACCTGgAaG
CATtATCCCATNNNNNNNNNNNNNNNNNNNNACGCAATTCTACCGAGTGCAAGTGTTGCGTTTtCTTTGCCGTTGCTTGAACCAGTCTTGAGGAGGTCTA
TCAACGGTGATATCGCGCCAACTTTCACAACTGTGTCTGCATTGGCTGCAGAATGCGATGCTATTCTACAGAATGCAAGCGCTGCGTAACCTTTTCCGTT
ACTTGGTCCATTCATGAGGAGGTCTACCAACGGTGGTATAGCGCGAGCTTTCACGACCGCGTCAGCATTGGAGGCGGAACTTGACGCGATGGATTCCAAC
GCATTCAGTGCATTGCTTTTTCCGTCACTTGAATCAACTGCAAGAAGATCCACCAACCCTGGTATCGCACCAGCTCTCGCGATAACTTCGGCAATGGCTG
ACGAAGTTGACGCAATACTACTGAGCACACATGCCGCGTTGTTCCTTACGCGGCTTGGCCCGGTAGTGAGAAGTTCCACCAACGGTGCTATCGCTCCAGC
TTTCATGATTGTGTCTGCATAGTCTGCACTCTTGACGATCACTTCTTGGTCTTTAGAGGTGGGGTGGACAAGACAGACTAGACCCTGAACAATTTCGACT
GCTTCGACCGAGAAATCTCTGGTCACCAAATACTTGGTGAGCTCGTTGACCAAATTATCTGTTCTTCCGTTGAACAGACCTAACTGAACACTCAGGCACA
TTGTAAACATGGCGTTTGTCCGAGTCTTGGCATCAAGCTTTTCGTCTGTCATCTTGACGAATAGACTCGCGAACTCGCGCTCGTCAGGTTGGTATTGTCT
GACCTTGAGCTGATCAAGTTCAGCACTCAATGATCCTGATAGAAATGACTGATCAATTCTCCTGAGATCATAAAAAGCATACATCTTGTTCAATGCGGAC
CACTCAGGATCTTTGATGATGCGAAAGTAAATCGGGTTTCCACAGCCATTCCAACCCTCTGGCTTGCACTTGTCGGTCTGGAGACTGCTGTAGTGCTTGA
ACAGCGGCGTCGACAGATTCAAAAGCGTCATCTTCGGCTTGGTTGCTCTTACGTGGATTCATTTCGTCAGCTGCAAGTGAAGTCAGCTTCACGGATTTAT
GTTCTGTTTGAACCGTGCTATGGGAACTGATGAGAAACGTGACTTCACCTCGGCTTAACTCCTTAAGTTCACTGATCACACTTCGAAGGCTCAGTCGGCT
CGCAGGTTCATAGTGTGTCATCTTAACAATGAGTTCCCACACCTCGTCTGAAATGCCTTCTACACGATCAGGTAACTCTCCACTGCAAATCTTGTGCTCT
ACTGCTTGCACCGTCGGCACATCCTGATACGGAATCTGCCCGCTCACTGCTTCGTAGATACACATAACAAACGAGTAGATGTCCGATTCAAATGTTGGCT
TCGTCTTGAAGCACTTTGGAGCACGCCAGAGAATCGCCCCTGCGCCAATGCTTCCAGCATACAACTCTGTCGCGGTCAACGTCTCTTTTCGCCGACTCAA
CCCAAAATCTCCCAATTTTGCCGTGCCATCAGCCATGATCAAAATATTATTCAGCTTCAAGTCGCCATGGGCAATCCCATTAACATGAAGGAACTGCAAC
CCGAGGGCCGCTACATGCAACAACCGATACTTCCGCGTAGATGGTTCTTGGCGTAGATATTGGCTCATATTCCCATTGGCAGCGAACTCACACACAATCA
ACGGCGGCGATCGAGAGTGACACGCACCGAAAAGCTTGATCAGGTGTGGGTGCGAGAACATGTAGCCAATCTCAACTTCCCTTACGAAGGAATCGCGGTG
CTTTTGATACTGGATGTCTATGTCATGTAATACCTTGACGACGACGCGGCTGCCTCTCCACGTAGCCGTGTGGACGGATCCAAACCCGCCGTGACCAATC
TCGCGCGATTGAAAGCTGATGTCCAGCTCGGAGATATACCAGTCGGGGGCATTAAAGCTTGACTCTTCGTCGAGCGAAGCAATCGGGCTCACGATTTTCC
ACAATGTCTCGGCTAGTTCGTTCCAGTGTCCACGGGCTCGTTCGTGTCTGAGTAGGAAAATGGTCTCGCGTCGAAACGACGGATCATTGAGCAATGCCTC
GTGCCCAGCACCAATCGACTCCATGATAGCGTCGTAGTGACCTGCTTTCGCGTGCTTGAAaTCATGTTGCCACGTACCTCGATAATTGGGTACgCCAaGA
AGCTCCATGACTTTGTCGACCCCTCcATtGGTATGCTTTCGCTGATCAGACTCACCG