Description :
Non Conding Region
Location :
Scaffold_1:139772- 139918
Sequence
146 bases(100 bases per row)
GCCAAAACTCAAGTGGTGAGAAGATCATCGATGCGCTCGACGTCACCCAACTTCAATATGGTGTGGTACACACTCACCTTTAATATAGCATACCCCATGT
AGTGTCATATCATCCGCAGCACTCCAATTGCGGCAGATCGGCAGCA