Description :
Non Conding Region
Location :
Scaffold_1:139735- 140149
Sequence
414 bases(100 bases per row)
GTGATGAATATACCTGAGGAAACAAGCAGAACACTTAGGTCAGGAGGCGTTGAGGCGTCCAACCCACACACTTGCGTGTCTTACCTGTCTGAAAAGAACT
GAGCGGTGCCGGGTGCAGACGACTTGGCGCAGAGCAAACCACAGCCAACCACAAGTTGGTGTGGCGTACATGCATATGGTACAATGTACCAGGTCAGCAC
GGTTCAGCGGTTACAATTACCCGCTAACCGGTCTTGCGGTTCGATTACACAATGATTCGTAATAAAGTTGCGCTGCTTACGTTGCTGTACGTTTAAGTTG
TGCTGCATTAATTTCAAGTTGCGCTTGCTGCAAGTTAACTTTTGCGTTATGTTTGAAAAGTCGATTCCAAACTCGCAGACTTCAACGCGCTGCACGCTGG
ACAAGTAGTACCAA