Description :
Non Conding Region
Location :
Scaffold_1:139539- 140341
Sequence
802 bases(100 bases per row)
GGACCCTGGACCTTGTAGCGACAAATTGAAGTGTGGTACACGGCTCGCATTGGAACACGTTTACCCCCAAACGATATCTGTACTAGCGAGTTATGATTTT
CCAAGGGTAATATTTATAATAGGAATGAGCTATTGGATGATCAGTCCGAACGGCTAGAATTTCCCGTGAATTTTTCAGGTACACACACTGAAAAGAAAGG
GGAAAAGCGAGTTGCATAGAGCTTCCTTGTCTCCTCTATACAGTTCGCGATTTGTATAGCCAGTGAGTCTATATTTCCAATTTTCCAGGCTCTCATACCG
CATCGGTGGGATAAAAGTACCACCCTGCTTGATTGTCTCGCGTGACTCAACAAATTTTCTCAACGAGCAATAGAAAATGAATTCCTAAACGTTGCAAACA
CAACCGGTCACTCATTGCGCCATAGGAAGAAATCAAAACAGCTGCACTATAATCCGGAAAAAGCTGATTTCAATGATAGGGTTGCAGGTTACGTAGCTAA
ATATTTTACATAAATTGAACCAGTTCCGAATTGAATATCAAAAACGAGTACCCTCGTCAAACTTTACACACTCACGCGAGGCGATCGCACGTCGAGTCCA
AACTTAGACTTACACAACTGCGTCTCTTTACGTAAATCATTTCATTGAACCGACAAAAATACCTCAGGTAGCTATACTTAATATTCCGTCCACTCCATCT
CTTTTTAAATTGCATTATGTAGTCGGAAATACCTGGATACGAGAACGCACTCTTACGTCACTGTAAATTACCAATAAATCCAAATTACTTTAGCATCCGC
GA