Description :
Non Conding Region
Location :
Scaffold_1:13928- 14981
Sequence
1053 bases(100 bases per row)
GCTACGACGCTCGTAATGATTACGGCGCTCCAACGCGAACAATGCAGACGGGATCGCTTCTGCCGCGACATCACTGAGGCAGCGCCGTTATAAAGCGCGC
ATCGTAGTCCACTGGGAGCGGAAGCGCCCAACGATTCCTGCTGACACACAAATATCATGCAGTAGGACAGTTGCAATCTGCGAATGCTGCTTCAAACGCC
CGCTTCGTGCGCCACTTCCGACAAAGACACGCGCTTCCTCCTTCTCGTCTTCTCTCGTTCGGGATTATTCACGGCGCCGCTGGCTGCCTATCTGCCGTCG
TCGTTCCAGTGAACCACCTGCTGCCACCGCATGCCCATTTCTGAACGTAGCTCTTCAGGATTGGATTGGAATTCGTCCAACGACCATGCGATATGCCCAT
AGTGATTACAGTTTTGTATTGGCTGAAATTTTCTATAAATTTTATGGTAGCCAATCAAATGGAGAGAGAGTAAAAAACGTTGAAGTTCCATACTGAAACG
AAAAGATCTATTTTTGGTGTAACGTAATGTTTTTAACCAATCAGAGCGCGCGAAAGCAAACGTCGCGTGAAGAAAATGAATCTCGGACGCCATGCCCAGT
TTCACCACGCAGCAATTATGCAGTCGCCCGTTATTGTTATTAAGAGCTCTATGAGCATGGGATGTGGGCAACGCGAACGGGTCTGGACCCACTGTTAGTT
CACGCAGATGCATTCATTAATCCGTTCGACCCGCTTGTATGATAAGCAGCCCTTTTTGCTCTAGTGAGAGTTACTCTGCAATGCGTTGGCGCGAAACGCC
GCTTCACGATGCGACCTTTCCTGACTGAGGTCATTCGATGGTCGTCTAGTCTTTTGCAACAAATACAAAAACAGCAGACGCTGACGCAGTTTGTCAAGGA
CATTGAGTGGCCGCCATGAAGCTTCGCGGCGCGTACATGAGCGTTCTGCTGTTTGGTCTCGTCGCTGCGGTAGCAGCAGTCGNNNNNNNNNNNNNNNNNN
NNNNNNNNGTGAAGATGGCGACACGGGATCATTTCGAAATGAGAGCTCTACTA