Description :
Non Conding Region
Location :
Scaffold_1:139243- 139728
Sequence
485 bases(100 bases per row)
GTTGTTCTCTTGGATGATCAAGCAGCGGACGATGGACATTACTACGATGCAGCCACAGGACCGGGAGCAGTGAATCGCACAGTGCAGCGTTTGGATCTCT
CTCGTCTGGTGGAGCAGCAGGTTTGCGTGTGAATAGGCTAAAATATTGGATTGGAATCCCTCCACCTCGCTGTTTGCCTCTGTTTTCTTCCGTCAAAGGA
AAACAAGGCGAATCGCTCTCGGTGGGGTTCTGTGACCCAATGCCCAGCAGCGCAGTCCAGTAGACTAGACAAATTCAATCAACAAGACATATTTATTCCA
GAGGAACGTTGGTCACCAGCATCAGTCTCATCCTGAGGATGAGACCAAGGTCGTCAACATGGCTACGTCCatcatggctacatttgaACTGTAGTATCAT
CTTCTTATTGGTCCAAATTATTTCCACCCAATAATCGTTCAGATAGTGGCACAACGTGGCACATTTTCACAATTTTCATCTAAGA