Description :
Non Conding Region
Location :
Scaffold_1:139096- 139383
Sequence
287 bases(100 bases per row)
GCACATTGTTCCACCATGGAGTGCGACGGCCGGGACTGTCGTGGCCGCGCTGGCCCGGGCAACATGTTACGAGTGAAGAGTGAGGGTGCTGCCAGTGGGA
AATCTGCATGGGCAAAGCATTCTCCATCCGGTCCACCCATTCCTGGTCATCGAGCCCGCCCAAGTTGCACGCAACGACGGCACGAAGGTTTGATAAGAAT
CCTCCTCTCCATATTGTACACAATCGCAGGTGCGACGACCAGACAAATGAAGACGACGAAACACAGGGCGATTGCCACGAGGAGGCG