Description :
Non Conding Region
Location :
Scaffold_1:138967- 140713
Sequence
1746 bases(100 bases per row)
CTCTGCGCTAAGCTGCGAAAACGATAATGACAGGCGACCGGACCAACGCGTGGAAGTCAAAGATCGTGGCGGGTCGGCTGCCCCAATACAGGCCCGCATA
CAAACTCCCAGCCACGCGTCCGTGCTGACGTGGCCGGGCGCGGGTTTGCCAGAGCGAGGAAAACGGGTCTTCTAGAAAAACCCGCCCAGAACGTATGGCA
GTTTGTATGCCACATACGAACACCAAGTGAACGACTGCCACGCGTCGGCGGAGACGTCTCCAACTAAGTGCGAAGATACCTGCAGCCATCGCCACGTTGC
GATGACGGACGAGCCCAGCTCAACATCGCTCGAATCGAGCTCTAGGAACGAGCGCGTGGTCACGGCGCTGTTGGCCGCATTGCCACATTTTCGCTGCGTG
GCAGCAGTGCCGCGCAGGAGCTGCAGCCACGTAGCCCCCCGCCGTCCACGACAGGTTGAATCGTACTTAGCTGAGTGCAACTCTCCACGTGGCAAGACGA
CAGCGCGAACAGCCAGCCCGTCGGCAAACCACTGCGATTTGCAACGGTGGTCGGCGCCTGCTGCGATCGCCGATCGCCGATCGGAGAAGGTGGCGGGCAC
GAGTTGGCTGCATCGACCTGCCTGCAAAGCGCTAGTCGATCCGTAGAAAAAGTGAAGGCGCACCCCAGCTCAGTCGAGGAATGTTACGAACAGCAACATT
CATTGCAGCGGTAGATGTAGGAGGAATCCCGTGGATGCACAGGATGACAACAGTGCTGGAAACGCTGGCAGCATATTAACGTTCGTCCTACCACGACTAA
AAGTGGCTACAGTACACTGTACTGCATTGCACAGTGCAGGCGGGACGTCAAGTCCGCGCACAGCTTCTCGGAGACTCGCAGATGGCCGATTTCGTACACG
TGGCAGAAAGAAACTGCACTTGTATACTGTAGATGTCTCCACCGCCAGAAGAGTGCGATTGTGGCCACCTGAGCTCATGGATTGATGACGACTTGTCAAT
CGAACGAAGCGGACCTGGTCAAGTTGTTGCCAGCTTCAAGTACTGTACCCTCATTTTGGTACCTTTGCGTGTCATGCGTCCAAATGAGTCGCTCGAAGCT
CGCCAAGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNTGCAAACCAACACCAACGTACTCATCGACTGCGGCAAAACTTTTCGAGAGGCAGCGCTGCGTATTTTCCCCAAGATCGGCGTCTCCGCAGT
TTATTCAGTGGTGCTCACTCATGATCATGCCGACGCGTGTCTGGGCTTGGACGACTTGCGCGAGGTTCAGCCTTTCGTGGAGACGGTGGATCCGGAGACG
AAGGAGGTGTACAAGGTCCCACCTGAATCGATGGCGGTTCACTGCAGTCATGATACCTGCCTGTCAATTCGAATCAGGTTTCCCTACCTTATAGAGGAGA
AGCCTCCGCCAGAGTTaggccggttctcaaccgaagcgtttttctcgacgcgtgcgttacatgcgtgccctaccccgtatgctcggttgagaatgaaact
gaccaaatttgattggcccagtgtttgatcaatattatccaatcattgcactgttactctgtgtgatctacgtgtggttcacgactcaacaatatctgaa
gcgctgaccaagactcccccgcccggcaatggggagcgaagctggt