Description :
Non Conding Region
Location :
Scaffold_1:138897- 139223
Sequence
326 bases(100 bases per row)
agacacgcgcgcagttcgccgtctagcggcgtccgaaactttacgcttatcgcctccatttttttgttttttgatccagcttttagaatattttcttcat
tgttccagaactagattttttaaatctggatacatttgatttgtacacctagactagatttgtaaagctccaattttgtgcatcctaataaaatacacca
agactagatttgtaaagctcaaattttgtgcatcctaataaaatgctttctttaaaaatggtccctgcgttttgataaaaagcaaaacaaagtgttttta
aacaaagttttcacgagtctggaaga