Description :
Non Conding Region
Location :
Scaffold_1:138652- 138729
Sequence
77 bases(100 bases per row)
CGAACGACAACAGCAGTGGGTCGAGTCAAAAACGATTCGCCTGCGATTCCTTGTGTCTGTTGATGGGACTCGTGGAC