Description :
Non Conding Region
Location :
contig_1:138502- 145216
Sequence
6714 bases(100 bases per row)
CTAGGTAGAAATTTGACTACAGCACGTGCACATTTAAAACTTTCAATGCATTAGTTGTGCTGTTACTTCCGATGACTATTTGAGGTGCATACTCATGACA
AGATATAACTTCATTTGTGTTTACAAATAAGAAAAACATATCAATTTGCAAAACGCAATGCCACCCGGGTGGTGAGTCTAGAGCCAAATGCTAAGCCTTC
ACCCCTGAGCGCACAGTAGGTTCCCTACGTTTCGCAGAGTTGACTACATGCCCACTACATTGTAGCGGAGGTAATATCAGTCTATGTACTTTGTCTGTAA
AAGTTGTATAAATGTTTGTGCCTGGCCAAGACATCGATCACCACAGATGTCAAAAAGAGGAATGCCAATATTTACCTAATTCCTCTTCCTAAATCGCCAT
ATTTGTGCGGCAAGTCAAGGTCGTAATTATTCGGCCCAGTAAATTACACCTAAGTCGTAATTTATCGTTAGGCACTTTTAGGTACTTTAGGTACTGTTTT
GAGGCAAGACATTTGACGCCCAGATTTCAAATATTTAGTACTAATAGCTCTACTAATTCCATGAATGCCTGAACAGCCTTTGGATCTTTGATGGCCGCAC
GCAATGGGTAGTTCTCCGGCGAACCCCCCCCCCCCCCCCCCCCCATTTCGCTCTCATTCTTCGATTCCCGTCTCATCGATCGCAACAATGAAGTGCGTCA
AGATTGACTGCTGCTTTGAAGACCTGGATGAGGCGTCCTCTTGTTGTATTTGCGGGCGACAGGTGCATCACCTATGGAGCAACGACCTCAGAAATATGGC
AGATCTATCAAAATGGTACGGCTAGCCAGATAAGCCAGATAGGCGAGCTTACTAACTCAATATTTATACAGCTTCTGTAGCCCCGTGCGTTAGCACCTTT
TTCGGCAATGCTGACGCTTCACAAGAGCTGACTCCGGTAGCATCTCTGCGTCTAGTCAGGCTACAGTGATCGACCTTGCTCAATCGGACAAGGTTGAAAC
AACCGCTCATCTAGGTAACATCTCAGCGTCGGTCGACCATCACGCTCCGGACAACACGACAGATTCCATCTAAACTGTCGTGCACGTGCTCGATGAACCC
GTCAAGTATCGCCGCAAAATGTTTACGCACATTTGTCTAACCTGTGCGAAGACCAAACTGTCTCTGCCAGATTGCACACGCTTCAAACGCGAAATCGCAT
GTTCTGCAATATCACCCGGAGCACGCGATATCTGTTAAGGAGGTCAGCCATCGGAAGCAGCGGAACCAGCGGTTCATGGTCGAGGAGAGTAGTAAACGCC
CTGCCCAGAAAAAGAAGCTGTTGAAGGTAGTCCTGAAGAGAAGCAGCCCGGTAATCCCCAGAAGATCTGGTGACAGTCCAAACCACACCAAGACTTTATT
TCGGGACACATCACGCGCTGGTTGATTCGAGACGGCAAGTCTGGTGTATTTATTTTTTATCGGCCTAATAAAACTATTCGTGTCGTTTGTGTACTACAGA
ACTATCCTACAATATGGTGACTACAATGGTCTTTTAAGAACTTGTTGCGGCTTTGACTGGGGACCCGATGTTACCATTCTAGCTTCTGAGACATACAATT
GCATCCTCGACAGTCATTACGAGAAATATCTGGGAGACACACGCGATTTACTACGCAAACAGCACGAACTGCTTCACGAGACGCCCTTCATGAACGTGAT
GCATGATCTTTGGACCCATAAATCAAAGAACTCCATCGTGGGAGCCTCGGGTCGTTTATCAACCACTTCTGGAAGCCTTGCCACTTGGCCCTGCTTGCCG
TGACTAAGACCGATGGACATGATCAGCTCCTGTCGAGGCGTTGATTAGTAGAGAGCTAATGACTCTGTACGGATTTAGTATGGAGACTATGGTTCGCTTC
ACGATTTCTGACACTGTACCTGCATCTCGTAAGACCTCAAATGAATTTGACATTACCCTCCAAACTGACTGTGCCATGCATGCACTGAATCGCTGTCTCG
GGTACGGCATTATACTTAAGAAAATGTGCGGACCCAGTATTTGACAGATGTCGCCACCGAATTGACAACCAAGAAGAGGGTCGTGCCTTCCCAGCAGGTG
GAGCGGTGACCCGCAAGTTGCGTGCGCTGAACAATTTCTTTGCATCCAGTAACTCCCCCGAACGTGTTCAGCGCCTTACTGATATTCAACGTTTCAAAAA
TCTACCCCAACTATCAGCACTACTGGACATCGTTCGTGTTGCATCCGCATCCAAACTACTTCGGCAATCGATACTCAACTACGCTGCCTTTCGCGCCTAT
TTCAAAAGGAAAGTGATGCCAAAACCGAGAAAAATAGCTTCGATTGCATTACGAGAGCGGACTGGGATTTAGCTGCTGAATGGAAGCGATGTGCAACGCG
TCACCAGTCTGGCAGTCGCAAATTCTCAATCTGCGAGTTTGCTTCATCGACTATGTACGTGTTTCTTCAGGTAGCGTCTGCACGCATGAGCTTGTACAAT
TGTTTTGCATACTGTCTCGATGGCTGCGATGAAGATACAAACGAGAGAATTTTGCCCGCATTGAGATGAAACTCGAGGATATCTCGGTTCTCGGCACTGC
TGTATCAGACGGACACTCCATCAAATAGCTAACCAGCTACCGATGCCTTCGGTACAGATGGGTATGACGCTACTCCTCGATCCACGTACGAAACGGGCAG
CTAAAAACTATCTCCGCATCCCGGATACAGCAGAAGCTGTCACTGATAGATTCTCACCGAAACAAAGAGCTACTGCTCATGGAGCACCGTGTGTTATGCT
GCGCAACATACGGGGACTGCACCCAAGAGAATTGTCCTGGAACTTAGCATCTTCGTCGTCTAACGAGTATACGGCGCAATGTGATGCTGATTTAGATTAC
TATGCGAGAGGAAGTAAGTCAACAGAACGCGGTCAACGCCGCGACGAAGACTCAAGAAAGAAGCAGATGCAGAAGTAGAGAGTGGCTAAACCACCGCGTC
GAATGGGTAGAAGTCGGAAAGTACCAGATTGCAGACGAAACCGAGCGCAAAGAAGTTTGGCCCAAGTTGACAATGCGCAACAGGGAAAATAAGAGCGTTT
GAAATGTAGAGCAGCTCTGTCAACACATCGCGTTTGCAAATGATTTGCTGAGTCTGGAGAAAAAGCTCCCTGCCGATCGCAAAAGTTGTGCGAGTCTGGC
TGGCCGGAGTTCTTCTACGGCATTTCAAGAACGTGTATTTTCAACTGGGTCGTTCGTCATGAGCTCGCTAAGGACGCGTACAGATAACGAGCGCGCACAA
TGGCAGCTCGTGCTGCACCATAATCGTGCCGAGATTGAGCGGATGGAGTCAAGCAAGTGCGGTCTGTGGTGAGCCGATTTTGTCATTGAGTTTAGTACTA
GTAGTTTCAATATTTAGTCTTAGTTCTGAGCCATCGCTGCTGCTTTAGTAGTGATAAACTATAATCTAACGGAAGCGAGGCGAATATTTAGTCTTAGTAC
TAAGGCCAAAACCACCACCACTACCAATCCCTGTCCACAAGTAGTACGAGTCGTAGTAGTAGCCCAGGCGCTGGCATTTGCCTACTACCTAAACACTCGT
AGCCTAGAATCTGCTCCATTAGGGAGGAGGCCTCCGCTGGCCTTCAAAGCATCTGTATTTAATGTGCTCTGAACGACCTGCCCTATATCATGTGTTCGCA
GACGTAGCAGTGCCGTAAAACATATGTCCAAACAGACAAGCAATCTTTGTGACGGACTACATTTCTATCCTATCATATTTCATAATTCTTAAAATAGACA
CTTTGACTGGTTGTTGATATGTCCGTAGGTTTACGGTACGTACCGCTGTCCTCGTACGGCGTACATGAGCTAACTTACACCAACCTGGCGTGGTATCGTG
TTGGTCCATTCATGCGCTCATGCGCCATGCTGCTTCACTGCATGTTGCATAATTTGAAATCTCCACTTGGTTGTTGGGGCCATGGCACTACATCCCAGAC
TTGATTTTTGTATCGAATTGGGTTGCAAAACTAGCTGAACCCGGAGTTCGCCAGTATCGGTTGAAATAGGCCCGTAATGAATGATTATCAACCCTTTACC
AAGCAGAGTTCTTGTAGCGGGCTACGCAGTCGGTTCACCTCGTACCTTAGTGCAACACGCACTAATGAATATATACAGGCTGACCACTCCACAGAGTGGT
CCACATTCATAGCAAAGAGATATGACTGGTAGAAAGCAACATCTTTCTACCAATGAGAGTCATTCATTAGATAGGGTTCGCCATCCATCCAATGGCAGAA
CCTCCATTAGAAATATCAGTTTTAGGAGGAAACCCCATTTACAATCAATACAGTTCTCATTTGGCACCAAAGCTATCGTTCGGTCCTTTATCTAGATTTA
AGTATACTTGTGGATACAAGTAGACTGGATCTAAGGTAAATACTCCTACGCTCCTCATACACGTGCGCACACGTGTAAGCTAAAGTAGTGGGTCTAAGCA
GACCCATTACACCTGGTAGCACTTTGTAGCCCGTCCAACGACCGACTAAAACGTTCGTATGGAATACGAACGCGGGTTGAGAACGACCTCGGACAGTAAC
ATGTTCGTGGGTAGCCCAACACGTCTGAAACGCATGTTGCGCGTGCAGACTGCCCCACCTAATCGGAACCAGAGTGGGAGGCCCTCCAACGACTGTCGAC
GGTCATTGGAGAAGCAGCGGTAGCAACGATGTTGTGTACGCTATCACCGACGGAGCAACACGATGTTGTTCTGGGTTTCATCGTGAAGGAGCAGCGTGAA
ACCACTGCTCGAGCTTCGGTGTCGCCTTCGGCACACCGCGCGTGGAGTCATTGACACTCCACGTAAGCAGCTATGTTGGAAGAGAGGGGGAACCTCTCTT
CCGTTGGCTTGTCGAGGCCGACACTGTCATTACTGCTCGACGTATCGTCGACCTGTTGTCGAGGGTTGCGTTCGCCATGTCATGTCTTGACGGACGAGCA
AGGAGTTGGGCGTACGAACGCCGACTCACAGACCCTACGTGCTTCAGCGCGTACGAGGTGTTCAAGGAGGAGCTCAAACAAGCGTTTGAGCCCCGCAGAA
CGAGTTCCGATCGAGGGCAGAGTTCCTCGATCTGCAACAGGGCAAGCATGACGTGCATGCTTACGGACAAAGAGCACGATACTTGGTCTCGAACATCGTG
ACCAACCCGATCGACGAGGCGACAAAGGTCGTCACGTTCATGAAAGGCCTTAGAGATGGGCCTATGAAGATCTATCTCTTCCGAGAGTATCCAAATACTC
TCGAGGCTGCAATTGGGCTCGCAATACAAGAAGAGTTTAGCCTGCGGCAGGCTAAACTGCATGTGAGCCCCGCGGCTAATGCCACGACCGGTGGTAAGGC
CGTCGGGAGGACCGGAACCAATTAACCTCTCGGGTGCGACGGCTGCTGGTTCCCAGCAGCGTCATGGATCAACGAATGTTCATTGTTTCCGCTGCGGACA
CATCGGTCACTACGCCCGCGAGGGCACAGCACCTGTGCGCGCGACCAGGAGCCGCGTGGCGATACTGGGTATCGTCACAGGCTAACAAAACACTAGAGGG
ACCAGCAGGACGCCCGGCGCCCTGCTGGTGATGCGGTCGAGCGTGTCGACATTGGACACGCTGTATTGAAGATCGCTGCCCCAGTGAGAGTCAATATCAC
TGCAAGAAGCAATATGACAAGCCGAATCTTGTCATCCTGAAGGTAAGCTCGAAGAGAGAGAGGTCTCTTCGTGCTCTAGTGGACTGTGGTGCGTCGAACA
ACTTTGTTCGACTGCAGAGTCTTCCAAGGCTTGACTTCGAGGAGGTGAAAACACCTCGAAGTCTATTGGAAGTGAGGCTAGCAACGGGTGTCGTTGTTAG
AACCGAGAAGCGTATCGTACGTGTACGCTTCTCATATCAAGAGAAGAAGTTCGATATGGTATGGGGCATGCCGTGGCTTGCACGGCATGATCCGGTGATC
GACTGGACGAAGCGCACGATCATGCACTTCGGGAGCAGCACATGCACCACGTAATGCATGCGTCCCTCCATCAAAGACAGCGCGGAATGCGGCTGTCTCG
AATCACCCCGAGGGAACAACAACGACTGCGAGAGTCGTTGGAAGAAAATATGAACCGAATCAGCAGGGCCTGATTCGATCGGATTCGAGAAGGTCTCGAA
GCGTCCGGAGTGACGCGGTCGTGTCGACTGATAATGTCGACACACAATTTGTCGAAAGACACTCCGCCATTAGGCGTCGAGGTAACGAAGACGCGTCGGC
TCTGTGAGCCGACGCTACAAGCAGTGCGGACGATTGCAAACGTCCCGCACCGGAAATGCTTGCGAGCTCGCGTGCAGCCGGGCTGCACGACGAAGAGGTA
CGCGATCAAGCCGGGCTTGAACACGTGCGCCCGCGGTAGAACTCGCCAGCAGATACAAGGAATATCTACCACGGTCGGGCCTGGACAAGAAGAAACTCGC
GGAGCCGGGCTCCGCACGAGAAGTGAACGGCGCAAGCGAGAAAAGCTGTGCAGGTCCCAATCAGGGACCTAGACGCTACAAGCAGTGTCTGCCGAACAGA
CACAGGAGTTGGAGACAAGCGTCGAGACCCTGAGTGTCTTGACGCGTACAAGTATTGGTCTCCAATACAAGAAGATGAGGCTGGATAATCCTCCGACGTT
AGCGTCGGAGTCGA