Description :
Non Conding Region
Location :
Scaffold_1:138405- 141760
Sequence
3355 bases(100 bases per row)
CTGGTACTTCAAGAATCGACGTCGTTGTCGTAGGAGCTGGTGACTTGAGGGCTGGAGGGGAAGTTGCGGGATGAATGAACGGGACCCTAGCTGGGAACTG
AACTTGAATGGAGGAGGTGTTGTTCCAATACAAGGGTGCGTTGCGTTAGGCTGGGAGGACTACTTTAAATTCCAAAAAGTCTGCTCGGTTGTATCTAACG
TTAGCTCGATTTTAGCAACTCGAGTACAACTATATCTTCCATACTGGAACACTTTGAAGAAACTAATAGATGTCTTCTTTGGCTACGAAGTAGCCAAGTC
TTGTGCTAATACTTCGCCTACTGAGTGGTCGAGTGTTTTGGCGCCACTACAAAGCTAACCCAAATCCAAAACAAAAACCATCAATACATGCACTAGCAGT
ACCAAACAGTGGTTACGTACTATGTTCACATGCAAGTAGCAAATGAGGGGCATAGCCTCTCATTTGCAGCGCCTACCATCATTTTTCTTAGGGAAATTTC
AGGAAGGTGACTCAATATTAAAATTTGTGCAAAAGGTGATAGATGGATTTGTGTCGAGAGCACATATTGGGCATTGGGCCACGACATTGTTGCCTCCAGC
GGCGACATGGGGAGTAAGGCATCCAAGCCGTCGGTGATGCTTTATGCAGTGTGGGCAGTGTCGCTTAAGCGACACCCGTACTCCACCAGAACAACTATCA
GCAGAGGGCGATGCCTACACCGGCACCGCCTTCGCGTTTACCCAGTGCTATACTGACACAATTGGTGCATTCAGCGACGTGCATGGCATTCAGGTGCTGG
CCGCTATCGGTGGCCAGATGCACTTGGGCCAAGTGACTTGGCACAAAGCCTTGTCTCACCGTTTGAGTCATATTCCGGAATTTTCCTTTTTTATATGGAG
CCAACTATCTACTGCCGGCGAAGCTGCCTACCGGACAGATTTTATAGTTTGTAGACCAAGAGCTAAGGACGTAAGCGTTTGCAGCGCCGACCACCATTTT
TTATATGGAGCCAATGATCTACACCTTTTCAACTTCAAAATGGCAAAAAGAAAACTCAATAGGGGGAGTCGAACCTGGCAAAAACGTGCTGATTTTTAGG
GCGATTTGATGTTGATTATTTCGGCGAAACCTTGTTGATTTTCAAAATCAACCACCTCCGGAGGTGGTTGATTTGAAAAATCATCATGATGATTTCGAAC
TTCAAGTGGTACCGCTTGCTGTTTCCTCCTCGACCTCTGATACAATTTCAGCTGTTTTTGAAGTCCCTCCTCAACTAGAAATTGTTGTGTATGTGTTTAG
GCAAGTTTTCACACGAATCCTCTCCAAATAAACATGTTCACTATCACTATAAACAAGTTTTAGATGTCAACTCGCGATGATGGAGACGTTGTGAGCTGCT
GGACAGTGTTACGTTGGAGTCGGCCATTGCTAGGTATAAAGCTGAATATAAGAAGATGTATATGCACTAAGCAAGAGACTGCGCGTGCTGGCGAAAAAGG
AAGTGATAATTCGCTGTTTTCACCAACTACATGCGAAAACTGAGAGTGAGTACCCTGCTTTGATTTGTTGATTTTTGGGGCAGAACGTTGCTGATTATTC
GGCCCCGTCTCTGTTGATATTTTTGTCGCCATTTTTAAGGTTCGACTCCCCCTAATACAGTCTGCCCCGGCAAATCAAGAAAGGTCGGACCAATAGAAAC
TGCGAGGTTGCGAAACTTGCAAAGGGCTTGACAGAAGTGCCAATGTACTGAATTACTCAATTAATGGAAAAGAAGCGCCTCGTCTTGTACCGTCGGCTCA
GTTTTCAAGCAGAGCGCGGTCGAAGGCACCATTGAACTTCAATTTGAAGGGGTCGGCGATATAATATCGCCGATATTCTTGTGTTTGTACTTGTACATGT
AGTGAATGATTTGTCTTGTTCGCGGAGCATCGCGTCGCGTAGACTGCTGCCTGGGACGGTCATTTAGGGAGTTCTAATGTCCGTACTGCCATCGTTCAGG
GCAAGGCACTGACGCCCCTGCCGCATGCCGTCATGACCGCATCTTGCTGCAGCAATAACTTATCTAAAGTTCATTTTGAGCCTTGCATTTTACTCCTGCT
AACTAGCAACTTACAGTTGCGTGTTGCTTCCCGCTGGTGGACATGTTCCCTCAACTTTTAACTAGACTCAGTACATATTATCCAGAAAGCGCAAATCTCG
ACTGCATGGCTGTACTAGCTCTGCGAGGTACATTCGACATCGCTATTCTTGATTTGCCGGGGAGATCTGTACGTCAAAATGTAAAATCAAAACGGCAATA
CTTTGTAAACCGATACTTAGACCTGTTTGGGATATATAGAAATACAGAGTGTCGAATATCTATTGGCTGACAGTGAGCTGCATCAGCCAATCGTGCTCGT
ATAAGATTGTGAGCTCTATTCGTGACAGTTTGAACTTACGTTTTGCCATTTTGAACTAGCAATTTGCCATTTTGAAGTTGAAAAGGTGTAATGCCAGCGA
GGCTGCCCGAGATCCAGGCGGACAGGTTTAATTTCTAGGCCAAGAGCTCAGCTGTGTGGACGTAAGACATCCTCAGTTATCCGTCAGTAACTAGGAACTA
TGCAATACAGTGTAGTTGTAGGCTGATTGGTCATCGTACATTCTCTTGTCGCTAACGCTGTCCTGATTCATTGTCAATTGGCTTTGTGTGGTACCGGTCG
GCTATATTTGTGTAGGTATGGTGTACGATTGTGTGAGTATGGTGTGGCGAGATGTTGTTTAAATGTTGCCTGAGGCACAAGCAACTTTTTTTCGACGAAT
TAATATGTGTGAGGCTGTCCATACAGCTCTTCTAGCTGTCCTCCCAGGATAAACTCTTTTTTCATGCATCAACACGAGTAAGCATAGCACACTGGCCGTT
TATGCAGTATGTCCCGTCAGCATGTCCCGTCAACATGAGTGAATCTAAATACCGGCCTTCCCAGGCAGGATAGTGTTTCCCTGCACGCCTTATTCCGGAT
CACTACTTCAGCCTGAAGTCTTCAGGATTGCGGGACATGCACCTCGAATACACAGTAAACTCAAAGCACGGGCAATTTTATTTAAAAAAAAAACACGCGC
TTGTCCTTCATGCAATGTAATGTTTTTCTCTTGGTTAAGAGTCACCCTCTGTAGTAAAACCCACCGATGTATCGTCCCGGTCGCTCGATTAATTTCTTAG
AATTCTTGTCCAGCTGCATGTCGATCCCTCCTTCCGCAAGATCGCCACCATATAACTCGCGGTCAGGATTGACAACGTCCGTAAGATACACACCGCAAAG
CACACCACTTGGAGTGAAGCCGGCGATGAGATCCAGAAACCATCTCGCAGCATGT