Description :
Non Conding Region
Location :
contig_1:138327- 138673
Sequence
346 bases(100 bases per row)
CACTGCCGCGTGAGCAAGTCAAGGCAATCGACGACTTCTTTGAACGTCGTCGCAAGGCAGGACAAGGGTGGAAATCTAAGTCCCCGCACAGCGCGCCCAC
GTTATGTGTGAAGAAACCACAGGGCGGGTGGCGCATCGTTCATGCTTACAATAAGCTAAACGATGCGACGGTACCGGTGCAGACGCCGATACCTCGAAAA
GATGTGATCATCGATTCGATGACCTCGAGTATTATCTTCAGTACTCTTGATCTGAGAGACGGGTTCTATCAGATCCTCATGCGTGAGAGCGATATCCCTC
TCACAGCGGTAAGCACTCCGAGCGGTATGCTCTGGGAGTGGCTCGT