Description :
Non Conding Region
Location :
Scaffold_1:138134- 138437
Sequence
303 bases(100 bases per row)
CGTTCTCTGCCAGCCTATACTCGACACTGTGCCCGTGGAGGTTGTACAGGAGACGCGCACCGAGAAACTCACGCGCGTGGAGAAGGCCCTTACCCAGTGG
CGTGAGGATTTTGAAGCTAAGAACGGACGGAAGCCCACGCGAGATGATCTTATGAGCAATGCTGAGTCGAAAAAGCTGTTCCAAGAGTTCGCAGCGCTGC
GAAAGTAGAGGAAAGATTACTGGGATCAAGCTGTCAATGTCACGGTTATCGGCTATTGACGACGCCATTTTCATCGTGTGTGAGGTTTGCTGACCTGTGT
CAT