Description :
Non Conding Region
Location :
Scaffold_1:138046- 138379
Sequence
333 bases(100 bases per row)
AGATGCAAAATGCACTGGTTCCATTCAGACCAGCGGTGGTTCGCTCAGGGTGAAAAAGAGCTCTAGCTACAACACGCTTGTAAATGAAGGCAACAGTGAG
AGCACCGGTCTTTATTCGACAAGGAAATGCTCGTCGGAAGAAAACAGCGACGACGACGAATTACAAGAAGGCAAAAGCGAGAACACCCAACTCCAAGATC
TACTCGATGAGATTCTAGGGTAAATGCAACACAAACACTTATGTTTGGTGATAAGTTCATCAGGTATATTGGTTGCTGTTCTTATCTCAATCATCGCACA
TCACACTGCTACACAGGATAGCAAGAGCGCACT