Description :
Non Conding Region
Location :
Scaffold_1:137723- 137972
Sequence
249 bases(100 bases per row)
TTCGTTTCTACAAATAAAAATGAGACCAAATAAGAATGAAATTGGGTTCTTTTTTATTTAAACAGACCATTGCCCATTCTGTAAAAAACACACACACACA
ATCGAATCCCTCATTCGCAAATAAAAAAACCCAGAGCATGTTAAGGGTCGGCACCACAACGTTGGCGCGGCGCTCGCTCGCTCCTCTGCTGGGTGCGCGG
TCCGGCAACAGCTCAATACTTCATAATGCATGTTTACAAATGCTACAGA