Description :
Non Conding Region
Location :
Scaffold_1:137645- 137686
Sequence
41 bases(100 bases per row)
TACTTTGTCCCTCAAAACGAGGTTTTGTGAGGGAAACGTGA