Description :
Non Conding Region
Location :
scaffold_1:137276- 138449
Sequence
1173 bases(100 bases per row)
GCGAAGGCGGAGGCGCTTGAGCTTGGCGAGGCAAATTCGGAAGTGTCGAGGATGGCGGATGTTGAACATGGTGAGAGGCTTTTGGACCGCTGGGACGTTT
GACTTGGCTTTTGTATGTAAGTACGTCAGCAGCTCCGTACGCTCGCAACTTAATGGATCATTTATGTAGACGATCCGGTGACGCGCCTTGCAGTCGGCCA
ATGGCAAGTCTGCGCCGGAACGCCCTTGGGAGCGTACATGCACCGCGCTGCTTGCTGGATGCCGTTGGTGTCGTGTACGACTCATAACCTTAGATGCTGT
TTAACATCTCAATCGTTTACGACTTCCCGGCAGGGAATCAGCAGGAAAGTTCCGGTGATCCCCGACTTGGAACACCACACACACCAAGCAAGATACGAAG
ACAAGCCCTCAAACGAGCTCCACTTTGCAAACCATCCTGGAGCGGAGGAAGACGGCAAGTACGCAATGCGCAAATACCCGCCCACAGCAGGGGCATCGCG
GTACGCTCCCAAGAGATTTTCCCCAAGAACCTCTCATACGGCATGTAGCCTTTCAAACAGCATACACATTTCCTTTAATGAGGTATGCTATATGATAGGA
TCTGTCCGCAATTTATCCGGCTGTTCCCACACCCGTCCAAGAGCATTTACATACAGCGATATTTGCTACGTGATAGGCTAAAGAAACTTGCATGGAATCC
GGCTGTTGCAGCAGCAGAATCAGACGCATCAGACGCATCAGACGAGTTCGCATCAGACGAGTTCAAAACTCTTCAAAATACCTTCTATTTCTTATATCTT
ATGACTCTATCGAATGTATAAGATTTCCTTCGAAAGTATAAGAGTGATAGAAATTCCGGAAATGGGAAACACCGCCGGGCGCCATCCAACGCGAATCCGA
CGCCGAAAATCGGCTCAGACATGAAAGACGTAGTAGTGATCCTGCCAGTCTTGTCTTCAAGGCGGACGCGCGCGTGTACACGCGCGCGCGATCGGAGTAT
AAGCACTAGGAGTCGGTACAAGGGTGATAATCTTGACGGGTTTGGGCAACAGAGAAATTGCGCATCACAAACTATTGCGCCGCGTCACCTTTTGTGTAAT
GGCGCGTCACCTTTTGTGTCCACAACGCTCATTGCAACCGTGTCATAGCCCAATCAGATCAGAGACACCACGA