Description :
Non Conding Region
Location :
scaffold_1:137099- 137726
Sequence
627 bases(100 bases per row)
TTGATATTGTCCACGATCTTCCGAATGGGGTTGGAGCATCGCTTTGACAAATCAGATTCCATTGAGACTTTGGTTGATTGACGTTGGGGTCAGTACTATT
CGTCATGGCGATGAAAATACTTGTCGTGAACGCGGCCAATTCAAATCTGAGTAGAATGCCAAAGTAATTGATCAACGACTATCATCACGCACACAGCTTG
AGCTGCCCTATTCGATTAGAGCCTATCGGTAGATTCATCCCCCGTGACGAGTTCGAAGGTGGCCAATGGGTATCATGTATTATCGTTCGGTGGTCGTTTG
AAGCATTTGAACACGAATATATGGCAGATACCCTTTATCTGCTCTTGTGAAGCAATACCCCACAAACAGATATGAAGTTTTCTAGCGGGTCGCTGGAAGT
TCTACGGTCGTACATGGTTTGATCTTCACGCTGATAAAACAGCAAAAGTACACGCGAGTCATGGAATGTCGAGAACACAATGCCAAAATAAAGTACTTCG
AAGTAGTGGATAATCCCGAAGCACTGTCGGCAGCACAGCAACACAGGGTTAGTTGTAGCATCGAATTGTCCAGCGATATACAACTACATAATGTCCTCTG
ACGAATTCAAATACCAGTACTCGAAAC