Description :
Non Conding Region
Location :
Scaffold_1:137088- 137204
Sequence
116 bases(100 bases per row)
GGATCGGTGTGTCCTGTTACTGAGCACAGTGGCGGGAGCCCTGCGAATTTATCTGCGTCGTGTTTGTTGTTAATAGAATGGCAAATGTGAAAGGTATGTT
GAAGTTATTGGCTGAC