Description :
Non Conding Region
Location :
contig_1:136981- 138026
Sequence
1045 bases(100 bases per row)
GATCGCTGCCCCCAGTGAGAGTCAATATCACTGCAAGAAGCAATATGACAAGCCGAATCTTGTCATCCTGAAGGTAAGCTCGAAGAGAGAGAGGTCTCTT
CGTGCTCTAGTGGACTGTGGTGCGTCGAACAACTTTGTTCGACTGCAGAGTCTTCCAAGGCTTGACTTCGAGGAGGTGAAAACACCTCGAAGTCTATTGG
AAGTGAGGCTAGCAACGGGTGTCGTTGTTAGAACCGAGAAGCGTATCGTACGTGTACGCTTCTCATATCAAGAGAAGAAGTTCGATATGGTATGGGGCAT
GCCGTGGCTTGCACGGCATGATCCGGTGATCGACTGGACGAAGCGCACGATCATGCACTTCGGGAGCAGCACATGCACCACGTAATGCATGCGTCCCTCC
ATCAAAGACAGCGCGGAATGCGGCTGTCTCGAATCACCCCGAGGGAACAACAACGACTGCGAGAGTCGTTGGAAGAAAATATGAACCGAATCAGCAGGGC
CTGATTCGATCGGATTCGAGAAGGTCTCGAAGCGTCCGGAGTGACGCGGTCGTGTCGACTGATAATGTCGACACACAATTTGTCGAAAGACACTCCGCCA
TTAGGCGTCGAGGTAACGAAGACGCGTCGGCTCTGTGAGCCGACGCTACAAGCAGTGCGGACGATTGCAAACGTCCCGCACCGGAAATGCTTGCGAGCTC
GCGTGCAGCCGGGCTGCACGACGAAGAGGTACGCGATCAAGCCGGGCTTGAACACGTGCGCCCGCGGTAGAACTCGCCAGCAGATACAAGGAATATCTAC
CACGGTCGGGCCTGGACAAGAAGAAACTCGCGGAGCCGGGCTCCGCACGAGAAATGAACGGCGCAAGCGAGAAAAGCTGTGCAGGTCCCAATCAGGGACC
GAGACGCTACAAGCAGTGTCTGCCGAACAGACACAGGAGTTGGAGACAAGCGTCGAGACCCTGAGTGTCTTGACGCGTACGAGTATTGGTCTCCAATACA
AGAAGATGAGGCTGGATAATCCTCCGACGTTAGCGTCGGAGTCGA