Description :
Non Conding Region
Location :
Scaffold_1:136929- 137341
Sequence
412 bases(100 bases per row)
TAGATATCACTCTAACACTAAGACTAAAGAAAGAGCTAAAGAAATAGCGTTTTCGTTTGTAATTTACGGTGGATGCCGCTGCTCTTATCTACATCGTACT
AGTAGTCCATGGGTCGCATGCCTCGGACGTCTTTGACACCTGTGTGAGGTATGTCTTTGAGTTCTCAAGCTCTTAGCTGCTCTTAGACTACTCATGTGTG
ATGTCGCTGTGAGCAAAACTGGTAAATCCGGTTACCAATTGCGTAACCGGATGACCACCATCGACAACGATAGACTTGCCACGGATCGTGAGCACGACCC
GTGGCAGCCAGCTGTATCAGCCAGATCGCTTGTAAGTGTTGGTGGCGTTGCCGCGCCCCTTCGTTGCGTCCAAGTCCGCCCAGCCACTCTACGTTTCTTG
CTATCGCAATCA