Description :
Non Conding Region
Location :
Scaffold_1:136550- 137500
Sequence
950 bases(100 bases per row)
GTACAGCAGTCAGAAAGAGCTAAGATGCTTATTCCTGCCGGGGAGGTGTTGAGGCTCTTATATCTAGGAGGTCGTTTCAGGCTGCGGTGTCTTTTGGCGA
ATGACCAAAAATTGATTGGACTCCGTGATGACATCTTCGGTGACTCGTCACTGCGGTGCCCTGGTCGCCGACATCTACTCTAGTAGCATAGTCTTGCTTC
CTCAATCACGGCAAGCATAGTTGGTGCATTCGTTGGCCTTCGCCCAAGTAGAGAGACCGTCGTTTCTGCAACGGGGCCTTGCATCACTTTGGCGAAAGAA
CCGACACAGTTTCCAGCTAAATAGCATTCAGCCAGGGCATCAAGTCAGTGACGGTTTTCTGGATGTCCATCGAACACGATTGCATATCGATGTCAACACG
CTGCAGCACGATGACCGCTGatcagcaacttcaaatTGAAATGATATAAATTACCGATTGCTGTAAAATACTCAAATACATTCTCCTACTGGGTATCGAC
GTAAAAAGGGTATAATATTTTATAAGAAAAATGTATCTGCCAGGTTCTTCGTTGTTACCGAATTAAACAGGGTATAAGTTCGAGTTGACCGCGTCAAATA
AATGACAGCGCGCCAACTGGGGCTCTACTTCCCGCCATCTTCGGCGACCAACCAATTCCCGCCCTTTCTCTGTTCACAGCATTACACTCGAGTGCGGGTT
TGCTTCTGCAAAGCACCCGGATTTTTAAGCCCACCCACCCATTTCTTCCCTCTGACTACAAATTCCTAAATCAATCTGGACTGGCGTCTCAAAGTGGTTT
CAAACTCCACTTCAACCCGCTTGGCCCACCCATTGTAAACCCGTAGCTCTTCGTGTTGCATGGCTGCCATTCGGCCATTTCTGTTGGCAAGTGTGGATCG
ACTTGAGTATTCCTCGTCCCTTCATCTCTCTCACCGATTCAAAGGCAACA