Description :
Non Conding Region
Location :
Scaffold_1:136495- 138684
Sequence
2189 bases(100 bases per row)
TTTTGCTTGAGCGAATTTGCTTTTGGCTCATTGCTTTGAGTTGACTAAGATATTTCGCTACCGGTTTACAGAAATTTGGAGTCAAATGTTAGTGAACGAG
TTGCTATTTAGAATTTGCTTGCTATATTTAAAGTTTTGTGTCAGAGAAGGATTTAGGACGGCAACCGATTTAGAAAAATGGTTGTAAAGCAAGAGTGATG
GTCGACAGCAGCGAGAATGTTGGTGGCGTCTGCTTTCTGAGCACAAAACGAGTCAACTGAGTCTGGTCGGATCTTGCTTCTTGTTTGTGCGTGGCGAGTG
GATGAGGGTGTGACGACATCGCGCGGCTGCACAGCAACCATTTCAATTGCTGGGCAATCAGCAAGCTTTGTGCTGAAAGAGTCCTTGCTGCGAGGCCGAT
CAATTCAGCCATATTCCGTGCGTTAACGTCTTGAAGACTTGAAGGCGCCAATACTGTTCACGTGAGCAATTGAATGGTGTTGGCAGAGGTGGGACCATTC
GACGTTGCTTGTTGGACGCAAACTTGCGTTCAGCAAACCAATTCATACTGTACTCAAGTGTCCAATGATGGATGGACTCGTTGGAACAAGTGCAAAGTGA
AAATTGCGCTCTCGTCGCAGAACATTCCTTGTTCCGACCTGCGAGAGCCACGAGATCAGAACAGTACATGTATATAAACATACACCCATGCGCAAAGTCT
TCCAGTAAGTCTCGCTTTGCGCTTGCGTGTTCTTGCGCGAATTCTCTCCCTTTCTTGCTTCTCTTTCTCGGTGAATGCAAAAGCAAAAGCCGCACGTGAG
GAAACCGTTTTTCTCTTTCGAGCGAGTAAGCGTTCTCTCTCACAGCTCACACGCAAGGAACCCCACTCGTGTGCTGTGTGTTGACCAACCGGCCGTGTGT
CGCAGCCATTTGAGCGCGTCGTACTGTACGCAGCACGCCCAAGGACGGAACAAACTGCATTGCACACATCCGTCTTTTGAGTCCATGTTCAAATCTCGCC
AGCAAATTTCCCAATTGCTGCCCAGGCAGCAAAATATTTGTGCGCGACAGCCACAATCCGCGAATATGATACTTTTTTCGTCGACTCGCGCGGTTACCGC
GAGCGACTGCGCTGCACGGTCTAACAAATGCCCATGTGCTCGAACAGGCAGGCAAAGAGCGCAGAGCAGCAAGGAAAGTCTGGGCTGCCCACATTTTTCC
GCCCGAATTTCTCTATTTTTGAATCTTTTTGGATAGATATGGATTGTGCCACAAACTACGACATCCCTCAACCAAGTTTTGATGGTGCAACATTTTGACA
ACACAAAACCACAGAGCTGCATGAGGCAACATCGAGTCGAGTTCACACCGCAATATGATTGTCGCGATTGACTCGATTCTCGCGCTCGTAAAATTGGTTT
TGCGGAGCTGCAGTGACGCTTGAAATATCGATCGATGCGGCTTATCGCGGTGGTAAATGACGTGATTGAACCATGAGAAAGTAGCACTCAGATTGTGGTC
AATCCACCCTTTGCGACACAACTCACTCTTCTAAGTTCGTTTCGGACTGTGCGTTTATCCTTTGATGCTTGAGTTTTGAAGGGTGGCGATACAATTCGCA
AGAGTGGCTTTTCTTTGGCGCAATTGCTTGGAGGCGGTCTGCGCACTGGCCTCCCTCTTCTTCTTCTTGGCTGCTCCTCACACAGCGTCATGCTGTCTTT
TTCGCGGCTTCTACGCAGGAAGACCAGCCACACACACAGCGCTTTGCGTACAGTACTGTACGAGAGGGTAAGTGGTCTTGCTGAGCTGAGCGGAGCGGAG
CGCGCTCTTCCTTCCTATCGAACGGTCGATCGATCCGCGTGTGCTTGCGATTCAAAGCAGAACCAGCTGGTGCCATCAGTTTGAAACAAGCGACTCGTCC
CGCAAACAACACGCAAGCAATAAACAAGCGAGCGAGCGGGCTTGTTCAGCCGTCTCTCCAAGCAAGCGTCAGAGAGACCCTTCCAAACAAGCGCTGCACG
CAACAGCAACAAACAACCAAGCAAACAAACAAGTCGCAAACAGGCGCGCTTGTGTTACTTCACACAACACACGCACGCTCGTTCGTCTGTCGGAAGTGGG
TTCACACGGACACCCGCCATTCCGCAACTTGCGCTCAACCGCACAGACCTCGCAGATCGCAGAGAGACGCCAGCAGTGAGCAGGCAGCA