Description :
Non Conding Region
Location :
Scaffold_1:136163- 138108
Sequence
1945 bases(100 bases per row)
AGCGACGCGGAGCCTGCACGAGATTGGGAGGTCATTGAGCTTCAGCCTCTGGACTTTCCAGTTTTTTTAGATTCATTTAGAGAAATAGAGAACTTCATTT
TTTGTATTTGTTGTTCGATGGAGCCGCACAACTCCCAGTGTCTTTAAGGTATTGTGCTATTATAATTCTTCGAAAGTGTACTCCAGCTTCAGTTGCTATG
CCCGAAGGTACATTTTCCGAGACCAGCAACCCATTTAGATTGGTAAACCCGTAGTGTGGAAACACTACGACTCGACAGATCGAACTCGACATTGTCTATA
TTTTCGATGCTGTGTTGTGAAGCTAGGAGCGGGAAGGTGTTCGCCACCACTAGCGTTTGCAAACTGGTTGTTAGTACATAGTGAATCTGGCTAACATGGT
TGCAGGGTTAGACGGGGTTTTAGTCGTTCATCTTGAGGCCCTTCTTAACGTTAGTTGCCGAAAGCTGACGAGTACGAAAAGCTCTTCTTCACAGCACCGG
TGAAATAATACATGTATCCTTACACCGGATTACTGTGGCTACGCCACACGCGGGATATGGATTCGACAACCGGTACCAATTTGCTTGAGGGCCCACTAAC
GTTAATTTAAACGCTAATGATAGAGCGCAAACATACAAACGCATTGCAAACAGCATTCACAATGACCATGTTGTACTGTACATGCATACTTAGTAAAGCT
TCTTATTGGCCATCAGAAACGAGAAAAATTGCGGCCGCCAACGGCTGCTTTCTTTTTTATTTCTAATTCCATTGGTGCAATAGTACGACTGAATACGGAC
AGCAGTGTTTGTTTGTTCTAGTCGAGCTGCGTGTCGATCCCGGGGCTCATTACGGCAACCGATAATGGAAAAGTTGACGTGGTGGAGTAGTTGTGTGCAA
CGAGTTAAGGACGAGAATGAACGTTTGACTATGAGGGCGACAGGTTGCTGAAGACATCTTCGCCTTTCATAGAGATAGATCTTGATTGCTTGTTGCGAGC
TGCTGATTCGGCTTTACAAGCAGACGCCCATGCCAGATTTGGGGCATCAAGTGGATTGAACGAGAATGGTTGGGAAAATGTGCGCTCTGGACTAGGAAAT
ACTTGAGAAATATATCTACACGTACAAACTTGGGTACGAACAATTCTCTTTCGAAGTCTACAAACACTTCGGCTTGAATACTGACAACCCGAAATCGTTT
TATTTTTTTTCAGAGCTGCCACTGGCGCTGATGCTATGGTCTTCCGCTCATCTCTGTAAACTTTGGAAGACCACCACTTCCTACAAGCTGAGTTTTCGCG
TACAGGAAGGTCCGTCCCAGGGCGTGGTTGCTGCGTACTCGAAGGGATTGAGTAATTCCTTGTCTAGAGAGGTGGAGGGAGGTCTAGCAAACTGAAACAC
CCCAATTCGGTGCAATTCTGCCATTCACCAGGTTTTCTTTGCTAAAAATCGCTGCTGCGGTAGCTTTGCCAGTTTCGAATTGAACGTGAATACCGCACTT
TTGAAAGATCTGCAGGGTCGTGCTGAATTGGCATTTGCTGAGGACTAATACTTTGTGGAGGCTGCGTTGTGGCGGCAGCCACACATGTAGGGTCCGTGTT
TATCTGTTGGCCATTTTCAGAGCTGAGTGCTAGTCGCCCCAAGCTGATGGGAGCGATGGTATTTTGTACTTGTGAAGAATGAATGAGCTGCAGTTAAAAC
AATACTGAGCGAAAAAGGCTGGTGCGTGTATTGAAGCGCGTTTGCAGTGTTACCGCGACACGAGCTTCACTCGATCCGAATGTCTCCCTTCAGGAACGTT
TTATAGTCGTCCACAAAGCGCGTGTAGTCCTCACCACCAAAGCCAAACTTTGCCATCCTTTTGGTGAGGAACTTTGGGTCAATAGCTAAGCCTTTCCACG
TCGCGAACGCTTCGATCTGTTGGGCCGCGTTGGCCATCACAAGAT