Description :
Non Conding Region
Location :
Scaffold_1:136162- 137929
Sequence
1767 bases(100 bases per row)
TCGGTCCGTCGGTCGGTGAATGGAATGCCCGCCCTCGGCCTATTctgagctgcttggccggAATTGGTGTGAGGAGAGACACTCTCTCCGCGCTGGCTTC
AGAAGAAAAAATCGTGTAATCATATAATATGGGAAGGGATATGAATGCCGTAAGACCGGATGATGCTGTTGAAAGGGTCATGCTGTACGCTACCGGCACG
AAAGGACCTCGTGATGAAATAGTACCGGTTTATGCTGTCTAATAGGATTGGATTACTTGTAGCTCGAGGTGAAAGCTGAGAATTTCACTGAGATTTGATA
GTTGCCTTTTTCCGGATGTAGTACATCAGACGCGTAATAGTCCCACTGTTACATATAATTTCCAAGTATAAACGTCGGTGTAATATAGTACTGTCGAAAC
ACTACTATCCATAGACTATTATTTCCACTTTCACGAGAGAGCACTATAGTATGTTTTGCAAATAACGAAGTACTACAGTGTAGTCACTACTGTATGTTGA
GCAAATTACAGTCGAGGGTTCTGCCAGTGGCGAACTGGTAATACTTTAAAAgatagtacatgtagtactaACATTATCGCGGGAAATACTGGTGCTTCCA
CAGTGATTTTCACTGGAAATTCCTTTTGAAAGCTACCGGGTACACGTAGCTGTTGTCGTTGGCTGTTGACAGCTTGTGGCAATTTGCCACAAGCTGTCAA
ATAGCTTTGCACCTTGTGCAGTGTCTCGGCGATTTggcgacagcgagcgagcgtcGTTACACATGCCATCGTCGTGGTAAGGATGCTCGACAGGATCCTC
GAGACTCCCGCTTGGATTTGCTGCAGGTCCACCGCGAACGACTGCAATTTGATGAATGGAGTCTCCATGGCACAGGGGGAATCGCCGCCTTTCGTCGAAA
GGCGCTGTGCCGGTAGTGGCAAGTGAGATTACTGGACTGCTGCGCTTCGATGGCGATCTCTGATTGCCACTGCAACGTTGCAGGTCTTCAAGGGCCGCAT
CGGTCTACTCTTATGGTACACTTCACCAGCACAGCGCTCCAATGATTCTCGGTGAAAAGCGATGGCCTGGCAGAGCTACCGTCGAGTCTACGCAGTGATC
ATGTACTGGTGCCATGTGTCGCAGTGCCGGGCAGTTGAGATACATGGTACAAGTAAGGTGTTCTGATCTGCAATTTGCGACGCGCACAAATATCCGTTCG
GCTTGGCAAGTGTGGCTGACGCCCGAGGcggggctgctggagagTCCTTTGACGCCCAGATGAGCTCCAAGTCTAAGCTATCTATGCTTTTGGGACTAAG
CACAACTTTAATGTGCTAGCTATTTGCAGAGCGTTGGTGCTAAGTTGAGGTCGCCGATGCATGTATCCACCATTCCTGATTTGGAAACGGGCACTGTAAC
GCTGTTTATCCACACAAGATGGCTActcttgagctccttcaccttgcAAGGTTCCTACGGACAATACTAAACGTACCAGTTCTCCAACGCAGCTTTGGAT
GAGACTGTGTCTATACATACAACTGCATCGTCACACCTGGGCACAGCGAAGGCAATGAGCAATAACCCATGAAGTGATGAAGTGTGATCCCAAGCATTGA
GCGTGatgcccccccccacacCAACTCTCTGAGTAGCCGGTCCTGTGTggcctccatcttctcctggAGCACCGCAAAAAGGGACACTATAAATATACGG
CATCAAACCCATCGCAACTGCCGACACTTAGCAAGCGACGGCACTCGATCGCTCCTCCTAGAGGTAA