Description :
Non Conding Region
Location :
contig_1:13616- 13691
Sequence
75 bases(100 bases per row)
CCACGCTGGAAGCAGCGCTACCCGTCGGGAGCACGCGCCGGCGTGATCGCGAGTCACGACGATGGCGATTCCACA