Description :
Non Conding Region
Location :
Scaffold_1:135820- 136984
Sequence
1164 bases(100 bases per row)
AAGACCGGTCTGGCATGCGAGCAGGGTGTCGTCGTGTGCGCTGCAAATTCAAGAGTGAAGACGAACAGGACCCCCGAAAGCTATGTCAATGCCTCTCGTT
CGTCTGCTGCCAGGAGCTCAGCAAGCTGCGGTGTCGGGACCCATCAGAGAAGCAAGCTGGAGCTGGAGTGCACCGTCGAGTGTCGACGGCTCCGGATGCC
TGGTGCTTCCGCTGGCTTGATGGTCGATGTCAACCGGTGCCTGACCACCGTTCGGGTGTTTACGGTCTCGGAGCGACGAGGCAGCGGTAAGTCGCACCTT
TAGATTGGTGCTTCGGCTGCGGGGCAAGTTGCTTCACGATTTTTTTCGAGTCGATTGTTGAAGTTGAAACGATCTTTGAATGCCACATGGTTGTCTTCAG
GCATTCGGTCTAAAGGCTCCCCGCCAGTCATCACGACGTTGCCTCCGGGCATTTTAGAGCAATAACTGCAAGCCGAATCTGCACCGCAAGCTTCCTGGCT
TCGTAGAAACTCGGGCATCAGCCCCTCGAACCCAGAGCTCCTGGCTGGAGCAGTTAGTTGTAGGCTGTGGCACCAATTTGAATTGCAGCTTGATGCGAGG
GTGAAAAGCAGCAGCGAAGATAGAGCCTTGCCGTCCCGGTCGTTACGCCATGCGCGTCATTTGTTGCAGTGGAGGCGGCAGACAGACAGCGTCCAGCGTC
CACTAGCAGGACAATTTCGGTGTCTGATCAGCTCTCCATTGCCTTTACAGTTCTACCGAGCTGCCAAAGCAACCACGCACGCAAGACGAATATTCAAACC
ATTTCGATGCTTGGGTGCTCAGGTCGTCGCGAGGTCGCCGGTGTGCACGGGTGTCCACAACGTCCAGCTGTGCGTGCAGCACACTTATCGTAGCTCGTCG
AAACCGAAGCTGGAGGCCAGTCATCACCCGAATTTGCTAATGTTAAACCGGCTCACACAGCCGGTTCGCGCACAACGGATGACTGGCCCCCGAGAGTGGC
GCGCCGACTTGCTGAGGAGGCAGAACGAGTGAGACCTCCCATGCAGAAAGGATACAGGAAAAAGCAAAAGCAAAGCCGAAAGCTGAAGGAAAAATCACCT
TACTTAAGTCAAATAACGGAGACAACAAACTTCCAAATGCATTTCGCAATTCGGGCTGTTCGTC